Description :
From Genome Similarity Track
Location :
Scaffold_46:411218- 415555
Transcript NameFunction/comments
Physo_108959protein serine/threonine kinase
Physo_157450hypothetical protein

Sequence
4337 bases(100 bases per row)
CCGTTGACATTTGGAGTGTGGGCTGCATCTTTGCGGAGATGGCCAACGGCGGGCCACTATTCGCAGGCACGTCGGAGGCTGACCAGCTCGACCGCATCTT
CCGCCTGCTGGGTACTCCGACGATGGAGATCTACCCGGCCATCATCGATCTCCCGGAATACAGGGTGAGGGAATGTTTTGTTTCGTTCATTTGCCGTCGT
GCTATCTATCTAACGTGCTTGCGATTGCATGTGCATCTACAGCGGGATTTCCCTGTTTATCCGACGCCGGACAACTTGGCACATCTCGTGCCGACGTTGG
ACGCCGATGGCGTGGACTTGCTAGAGCAGATGCTGCAGTATGACCCGGCAAAGCGTATCACCGCGGCTGATGCTATGGCCCACCCGTATTTTAGCGACTT
GTCCCCGGCGCTTACCGAGAACCAGTGACCGGCAGCGCCAAACGGTTGGCAACACATGAATGGATAGTGGACAGATGAGGAGGCTGGTGGAATGGACGTC
ATCCTCCTGAAGTAGCGTGGATGGTTCCATGTAGTAGTTTTTTACCTGTATTGCTGTCCGTCCATAGAAGCATTTTAGTTTTTGCGAGAATGTTAATGAA
GTGGCACTATAGCGAAAAGACGCAGCAAAACGGGTCATCGCTGTGGAGGATGAAGAAGCACCATGCTTGGCAGGTGCGCCGATTTCACGCTGTCTCCGTC
TTGATCGTATTCTCGTTCTTCTCTCTTGTTGCAGCCACCTCCAACACCAATTCACTGTTGACCAAGTGCATTCGGAGCATACCACGATCTTTTTCGCAGT
CTCACCAGCAGCAGCTATGCGCCGCAATCACCCGCAGTCGCCAAGATCCGACTGTACCGGGGCAATGTGCTAAGATGGCGTTGGGAGGGAGAGCGTTGCA
GTCTGCAAAGTTTGCGTCGCGAATCGAATTACTACGTGCTGCCTCGATTGTCCAGCTCTGCTCGGGAACACAACATACTGGCCCGGCAACTTGTTGGCTT
GCAAGTCCTGCTCAAGTGAGGCAGCAAATGCTTGTATCGTCAGCGTCTGCTTCATCTGACGAAGAATGGGACGCGGAATCCGAAGCTGCTTCACTTTCGC
TGGTTCAAATCTGCCGGCGCGCTCGAGACGATCGTCCAGCTAAGTGCTTGCTCCTTTGGCTCGAGATGAGCAGGACGCTTAACAAGCGAGATGTTCATGA
CGTGCTTGAGATTGCTACTGTACTCTGCAGAGATTTTGGTGGCCAAGTCGAGGCCCTGAAGCAATGCGTGAAGCAAGTTGCACCGAATTTAAGGAACGGT
GTTGGCTCTGAAATCGCCACTCTGCAGCTCTGTCAATCTATTGGAAATGGTGAGAAGTTATCGGCCATGGTACAATGCACGTCCAAACTCGGAAGAAGGC
ACGTCGCTCCAGGCACAATCGCCCAGGTCTGCGCTGATACCTCCGGTATCAACGATGTTCTTCCGCATGCCTGCTTCTTGGAAGCACAACAAAAACTCCG
ATGGATAGATCAAGCTGCGCAGATTTCGTTATGCAAGGATGCCGCTGCACAAGCTGCAACAGTGCCAATACATTGCGCAGTGGAGTTGAAGAGGATGCCA
CAAAAATCACTGCTAACTCCGGGTTCCCCAGCATTTAGTATGCTCATAGCCGACTTGTGCCGCAGTGCTACAAATTCCACCGCCGTGATTGAATGCGTGC
GGCTTCTGCCAGTCCGTGCTTTCACGGCCGATCAAGCTGTACGCCTTTGTGCCGCCTCGTCAATGCCTGCTGTCACTTATTCTGATGATGAAGCTTCCGT
CTCGCTTTACCCGACAAGCTGCGCTTCTCAAGCTCGGTCACTTCTCCAGCGAGTTGAACTACTACCTGGTTCGAACGACCTGGGGATGTCAGCATCTGCA
GCTGCTGTTCAGGTGTGCGAGCAAGCAACGTCAGACGCACCGAGCCAGTGTTTAGCAGACACTCAGCACGAACAAGCGCTCTCGCCGAAACTTCGGGTGC
AGCTCTGCCAACGTGCAACGTCTGATGCTCCACAACTATGCGTGAAGTCACTTCGGAGATTTATCAATGCGCAGCGTCTGGATATTTACGACGCTGTAGC
TGCTTGCCGCCAAACGGAGGATCTGGGCCCCGTGGATTGTGTGACGGAGTTGTTTCGAGTTGCTACCCCACCGCCAGGCAGATTAGCAGCTCAGCTTTGT
CATGCTGCTAAAACCTTGGAGCCTGCTCGCTGTTATTCCGCGTCCCCGCTTATCTACGACGACGAATTGAAGATATCACTGTGCAAGGAAGCTGAAAGCA
CGGCTCCAGCATTATGCGCCGACTCAGTGATCTCTCGTATTGGCAACCAGCCGCTCGGGAAGGTAGCCTTGTGTCGAGGTGCAACTAGTTCTGCACCTGC
AGCCTGTGCCATGGAGGCTCCGTTTGGAATGGATGAGCCAAAGGTGGTGCTATTATGCCGATTGGCGACGAGTACTGCACCTGCAAGGTGCGCGCAGGAA
GTGCCGGCATTCTTGCGTATTCCCTGGGACAAAGTGGCCCAAGTATGTGCTGGTGCCACATCCACGACGCCTGGACGCTGCTTGGCGCATCAAATCCGCC
ACTCCCGTTTACTGCTTCGAACAGTAGACAGCGCTCAAATTGTGCGCGAGTGCCGACTCGCAGTGGCGCGGCCTTCAGCATTGGGACTTGCAAAGGCGTC
GTACAATTGCCCGGAGCTCCGTCCGATGTACCCCCTGCAGCTCGTGGTGAACGTGCTGGATCAATATGGCGATCTCATGACCGAAAACTACGCTCCGCAG
TACCGCGGCAATGACTACGTCCCGCAGTACCGCGGCAACAACGTTGTCTACCTGAGTGGCGTATTTACGGGAAGTCCTCACACGGAGGATAGCTACCTTC
ATCGTGGACAGCCAACACTGCAAGGCTCTTCATACGCCACGATCACCAATGGCTCAGCAGTCTTCTCCAATGTACAGTTTACCGGTGCAGGAGAGTTCAC
CCTCACATTTCGATCCGGCGAAGGCGTCACCGAGGAAGTCGCGCGAGTCGTCGTACATCCTGATCTCGCTGCGGCAGCCTTGCAGACTCGATGCGACGAA
TTGTTCACACGCTTCAAGTGCAGTCTCCAGTCGCCTGCGTCTCTCAAGCGCGACTACCAGCACCGTGAGCTGCAAGTGTTGCTTCTGCCACGATATTTTC
ATTTCAACGCTGTCTCGTGTGAGCGATACTGGATGGACAACATCGGCGGCCTCGCGTTCAGCGGCTTCTCTTCTGGTAACGACGTGCTCTACGCCCTCCC
GCGTCCGCTGTACGACCTCTTCACGTACGTAGCCCTCACACATTACTTTCCTCTTCTTCCCTCCATATTCACTGGCGGTTGCACTGTTCCCCACAGCAGA
AACTCAGACGTTCCGCGTGTGGACATGAGCGCTTGGGCTCTGCTGGGCCTGAAGGAGGGCGAGACGAGCCGCGCCGCCATCCGACGCGCCTACCATCGGC
GCTCGCTGGAGTGGCATCCAGACAAATGGCACGCGCTGGCGGCGGCACTGCCCCCAATATGGCAGCAAGAGCTGGCTGGAGCCTACGCGCTGATCACTCG
GGCCTATGACCAGCTCACTTCGGCAGCACGTTAAACCTCAACTTCAACACGATTAGACTCGCCAATCAGCCAATCAGAGGGCTCCAATATCGACCGAAAT
TGCGTCCGGTTCGAAGAGTCTCACAGCAGGAAGAAAGCGTCATGCAGGACGCGCTGTTGGCGATCCTGCGCGGCGTCCGAAATGGGTCGTTCTACGGCAC
CAAGGTGCGCGCCCCGCATGGTACGTGGGTCGCTCTACGAACCTCCGTCTCGCCTTGTTGTGCTGACTTTTGCCGCGTCTGCTGTGCGTGTATGTGGGAA
CAGCCATGGTCATGATCTTCCTGTTCCAGAAGGGCTCTGTGCGCCAGAAGCTCCGCGGCGTCATCCGCCTCACGTTCGAGCACAGCAAGAACCTGGCGTT
GTTCGTGGGCGTGTACAAGTCGGTGCTGGCGGTGCTACGAGCGCACCAGCATCACGCGCTCGGACAGCGCGTGACCACGAGCGTGGGGAAGCCCGGGGCG
CACTGGCACGCGGCGGTGGCCGGCGGCATCGGCGGCTACCTGGTGTGGGGCCGCTACTCGAGCGTCAACTTCCAGATCATCATGTACCTGATGTCAAGAG
CGCTCATCAGCCTGGTGCGCGTGTTGGCCGCCAGGGGCTACCACCCGTTCGCGCAGCACCGCTTCAAGCACGTGTACCCGCTGCTGGCCACCGTGGTGTG
GGCCGGCGTCATGTGGCTCTACGAGAACGAGCCGCAC