Description :
From Genome Similarity Track
Location :
Scaffold_129:41113- 43567
Transcript NameFunction/comments
Phypl_g3789conserved hypothetical protein

Sequence
2454 bases(100 bases per row)
GGAATCCGAGCCACATTTCCACATTCCGTGACTCTTCGCGATGGACGCCCCgatggacgacgtggccatggagcAGTACGCCGATGTACGTTGCCCCGTT
GCCGGTGCATGTTAAAGAGCTGCGGATTTGGCGCGGAATGGAGGTGGAACGCTCTCTCACCGCCCCGTTGTGGTCCCGTGGCAGTGGCTGGACACGTTGG
AGAAGACGGATCCGGAAGGCTACAAGCAGTTCATCGCTACGATGCAGAGCCAACTGCAGGCCACGAGGATGGGACCGGAGGCACCACCGGGTGCGCCACA
AGGCGACGCTgacgcagcgctgctcgaTATGCTCAAGAGATCGGCTGgtgcacgaggaggagctgcggaCACCAACTCGCCAGGTATGACGCGTGGATCG
TCGAAAGATGCAGTGGACGAGAGCTTTAGATCGGATTGACACTCATGGTGCATTGTGCAATTGATGACGACTAGATTTTAAGCCGCGGTTTCCTGGCGAC
AAGGTCATGGGGGAGGACGGCCTGAAAGCCACGCCGGAGGGGGTACGAAGCAACCTTCGATCGGTTTGAAGTGTAGATTGGGTAGATCAAGGGCTGACTT
GTGATGCGCGTTGTATGACAGATGTACATCGACGTGAAACCTGGTTtcgtgatgaagacgaccgatgtcaagaacaagaagaaggtgtgAGGCCTGCTCT
GTTTCCCAAGGACCCCGGGGACATGTCTAACTATCATCATCTTTGTGAAACAGGTTTTCGTAAATGTAGTCTATGCAGACGAAATTCAAGCGTTttcgga
gaagaagaagctggacgatgAGGGCAAAGAACAAGAGGTGAGAACGTATCCGATGTTGTTGAAAAGGTTCGTACGGAAATTGACGTGAAGTGCCGCGTGC
TTAGGGAATTCACGTACCGCTGAGTCTGGGCGCGCCTCATGAGGTCACGGATAAGAAGGGAGTGAGTTCGCTGGCTTTTGACGTGGCAGTGAACACAAAA
GTCGTGGAAGACTGCCAAGCAGACAAAACAGGCGCCTTCCGCAACTTTGTGTGCGAGCTTGCGATCGAGTACATCGACCAGAAGGTACAGGTTCTTTTCa
ttttttgttgttgcatACGTTAGTAGGCAAGCTAAACGGGCATGTTGTCATTGATGCAGTACAAGATCAAGCTTGATGATCGCTACAAACTGCCTCGACT
GACATATCGAGGAGAGCTACCACCTCCCAAGCACTACATTCGCAAAACACAGGCACCAACCATCCAAGAAGTTGCAGCTTCAAAAACAAATGGTAGCGCG
AAGTCTGTAACAAAGAAAGCAGCAAAGGGTGCAAGCGTGCCGAAGACCGCTACAGCGACGTATGCGGTGTTTGAGGAGCGCAACGAAAGCCGTACGGTTT
GCTCGAGGACCCCATCAGCGACGAAAGGCAGTACACCACTATCACCCGAGGTGCTTGAGCAGTCGGGGGACCGGTTGGTCGTCTCGATTCAGTTTGCAAA
CAAAGTGCAGGCCGCCAGTGATATCGAATTGGAGTTGCATGCTGAGCTATTGAGCGTTAAGGCTGCTACTCATCACGATTTGGGTAAATGCGATACTCTT
CATTGCTTTAGTGCTGAGGGTGACTAACTTCCTGTACTTGTCGTGCGTGTTTCCAGATATCTTTCTCCCTTATCCCGTAACGGTAAACTCTGCGAGAGTT
TGCTTGGATCTGGGTCGCCACACGATGGAGATAATCCTCACAATCGACAAGTCGTGGGATAGTGTTGGACCCGACTGCGGTTCAGCTCCATGGCTGCTTG
CACGGGCGCTAGATGAAGAAAGCGACGCTGAGGGTGGAGGCAATAAAGACGAACTAGCAACAGCGACTGAATCTGCGAAAGAGAAGCCCAAGTCACTAGT
GGAGATGTTCCATCTTGCCAATGCAGCGGAGTCGAACGACGGACCAGTTGGAAATGGACCCTCATCGAAGGCTACTCCACGATGGGACCCTGTCCtggaa
gacgaagaactACCTGAAGACCGATTCCACCGCAAGGATATGATGTCCATGCACATCTTGGAACAGCGGCGAACTGAGCGCGAACAAAAGGCGAAGGAGA
CAGAGGTCAAGCGGAAGCAGAGGCGTGCTGAGGTGGAAGAAATGCAAAACAAGGCGAAAGAGGCTGGCAAAACCTGGCGCGAGATGTATCCGAATGAGCC
GGAGACAACCTACATCGATGTGGAAGACATTGTTCGGCAGGAGAAAGAGAGGCTTGGCCGCCACCAGGAAAAACAAGAAGTAGAGGAGGATCCAGCGAAA
GAGTGCATGCCTACGGAGGACGCActgcgcgcggcggcgaaaTGGTCCGAGAACAACGAGAACGGCAGCCTCGACTTGCAATCTGCATTGGCATTTGATC
TGCTCTAAACACAATTTTAGACTGCAAACACGAGTTCTTGCTCCACTAGTTTGT