Description :
From Genome Similarity Track
Location :
Scaffold_693:41106- 42415
Sequence
1309 bases(100 bases per row)
TTAGTTAACCCTTTCGCGGTGGGAGGCGGTTTTCTCGCGCTTTAACACTATTACCAAAACAAGGTGGAAAATGAGCTTGTAAAAGAGCGAATTTTGCGCC
CTTTTAGCTTTTCCTCCAACTCTGTCTACCATGTTTCGTAACTACCAATCGCAGCAGTGAATAGAAAGAGGTTGGAGGTAATTTTGGATCGTCTGCTCAA
CGCACAGTATTTTATTGCTCCAACGACCGTAATCGGCCCTTTCTACGCGGTCGTGCCATGGATCTAGCGGTCAATCGCCTGACAGCCAGTCACCAGATAT
ACAAAAGGTAAGACGAATGCACCTCTCCGACCTCCCATTTCGCTATAGTGTACTCAACACTAATGCGCACTACCTTCACAGACACTGAAGATAAGCTGCT
GGTGCAGATCGCCTTTCAATTCGAAAGGGAGGGCTTACGAATCACATGGGCCTACGTGGCCCGCCCGAATGCAGACCAAGCTGCCCGGCTGTCAACTGCG
GCTTCGGCTGGCTAGCATCAAGCGGACCTATGGAAAGGCGATAAGTGGCTTTCCGCCATGTTTTCTCCGCGGCATGCCATCAGGCGTCTTCTCGGAGCGC
TGAGGTCACAACCACCACCACCCCTCGTTTGCAGCAAGTCGTAAACCAGCATGCCGACCTTCTGCTACTTCGTCAAATTCTCTACTTCTCGGCGGCGATC
GCCACATGCCAGGTTCGTCTCTTTTGGGGATATTTGCATGCCGATCGTGAGACTGATGACGATAAGTTGGTGGCGATACGCATGGGAGCGCCGCCGGAGG
CAGTCAGATGGCAGACGACGTGGATCAGGGAAACCAAGACTGTAGAGGTGAGGATACAGGACCCGCTGGCGGCTATATTGCGCGATATTGCGGGGGATGC
TGTCAGCCACAGGTGACTCAGGCGAAAAGCGCTTCAGGTGAGTCTAGGATGGTTGGTTCCACAATTGAGCGTCGGCAAAATACTAACCTGTGTGTGTAGG
TGGCTGGTGTTGGGGGACTGTGGGAGGCAATCTGAATCCAGCTGAAGCTGCAGAAGCCGTGAATATCCTTTTTCGAAGATATAAGTGCTCACGACGTTCG
CCAGCCCGCTGGACGCACATATGACAATGCTAGTGAGGTGCTACCGTCCAGTGTCACCCTTCTACTTGCTGCCGTCGGACCACTCGGCGAAGCTGACGTC
TTTCTTGACGTCGGATCTGGCGTTGACAACGTGCTTGCGCAGGTAGCACTTACAACGAACGTCAGAACGTGCATCGGGATCGAGCTGCGAAGGGAGCTCG
TCTCCCTTG