Description :
From Genome Similarity Track
Location :
Scaffold_4:411- 3955
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4-fgenesh-gene-0.1Ubiquitin-activating enzyme (E1)
Pytiw_DAOMBR242034maker-piw_contig_4-fgenesh-gene-0.24-nitrophenylphosphatase

Sequence
3544 bases(100 bases per row)
ATGGTCAAGACGCTCGGACTCGGCGAGCAGAAGCTGCAGCTCGCGGCGGCGTTCGGCATTGGCGCGGCGGCGGCGCTCGTCGCGCAGCTCGCGTACATCA
CCATCGCGAAGAAGCAGACGCGCCACAAGATCCCAAAGAGCTTCATTGGCAATGGCAGCAAGGCCAGCGAGAGCGCGCCACGCGCCGTGGGCACGGAGGC
CATGGAGGACGCGCTGATGCAGGAGCAGCTCTCGCGCATCCACACGTTCTTCGGCCAGGAGGGTTTCGACAAGGTCAGAGACGCGTTCGTGGTTGTCGTG
GGTGTCGGCGGCGTCGGCTCGCACGCAGCGCACATGCTCGCGCGCTCGGGCGTGCGCAAGCTGCGCCTCATCGACTTTGACAACGTGACGCTCTCGTCGC
TCAACCGCCACGCTGTCGCGACGCGCGCGGACGTGGGCACTCCGAAGGTTACTGCGATGAAGAAGCACTTGCTTCAGATCGTGCCGCAGTGCGAGATCGA
AGACGTCGTGATGATGTTTGAGGAGGACGCGGCGGACGAGCTCCTCGAGGGCAACCCGACGTACGTGATCGACTGCATCGACGACGTGACCACGAAGATC
GCGCTTCTGGTCGCGGTCTCGAACAAGAACCTCAAGGTCATCACAGCCACGGGCGCTGGCGCCAAGGCGGACCCAACGCGTCTCCAGATCGGACCGATCA
AGGACGCGGTTCGGGACCCACTGGCGACCAAGATGCGCTACTTCCTGGCCAAGAAGGGCATCGACACGACCAATATCACGACGGTCTTCTCGAGTGAGAA
AAGCGTCGTGAAGTTGCTGCCACTGGACGCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACCCGGCCGATTTTGGCAGCGTCGAGAACTTCCGCATCCGCGTCATCCCCGTGCTCGGAACGATGCCGGCGCTCTT
CGGTCAGACCATGGCGGCGTACGTGCTCTGTGACCTGGCCGGTCAGCCGTTCGCACCAGAAGCAATCGCTCGTCTGTCGCGCGACCAGCGCAACAAGCTC
TTCCAGAAGCTGCTGGACCGCGAGCGCCACCTCGGCATCGAGACTGGTCGCATGCAGCTCGAGAAGGAGGAGATCGAGTTCATCTTCCAGGAGGTCTGGC
GCGGCCGCAGCTCCGTGTGCGGCGTGCGGCAGGGTGGCCACCAGCGCATGTTCCTGGCGCGCTGGCGGCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGCTGCGCCCCGACAACGTCGTCTTCCTCACGCACAAGGAGCTCA
ACCTGCTGGACAAGCACGGCATCGACGCGTTCGGCGACGAGATGCGCAACAAGATCGACGCGCGTCTGCAGCAGTTTGGCGATTGGGCCTAGGCAAGTGA
GTACCACACACGTGCGTAGATAGAGCGCGAGCAATGGGTCACATACATGATAGAGCAATGCATCCCTTGCAGCTGTATTTTTGATAGGCATCAAGATTCA
GGTCTTTTGTGCGACATGCGTCATTTCAGCCCACAAAAAGTGGTGGATAGTGCCATAGGCTGATTTTTGATACAGTGTCTGTGTTGTGGCCTCTTTTGCA
CTTTTTGTGTTTTCCATACAGCCAGGAATGATGAAAACTGTGTCAATAGCCACGCTGATTTTGGAAAACCCTCGCATTGCGTCATTGCGTCATTCCTCAA
TCTGCCACGCACACGCCCAAGCAGCCAAGTGAAGACGAGACCCAATGGCGCAAGCTGTCGCAAAGGTGACCCCGCAGAAGCTCGAGAGCCCCGCGTGGCA
GCAGTGGATCGACAGCATCGACGCCTTCCTGCTGGACTGCGATGGCGGTGCGTCCTCATGTGTGCGTTTGGGCTGTCCTGATGAGCGATCTGATGAGCTA
AACATGCGTGTATGTGTGTGTGTAGTGCTGTGGCGTGGAGACGCCGCGATCCCAGGCGCGCACGAGATGATCACGCTCATGCGCTCGCTCGGCAAGCGTG
TAGTGTTTGTGGTACGTCTGCTGGTTGTTGCTGTGGTATGGTGCAATGGATGCGAGTGGCTCACTATCTCTATGTGTTGTATTCAGACGAATAACTCGAC
CAAGAGCAGAGACACTTACGTCAAGAAGCTCGGTACGGAACGACTGCATTGCTGCATGTAAACACATATGGAGAGACTTATCATGTGTATGTGTTGCTGC
TTCAGCTTCCCAGGGCATCACTGCTACCGTCGACGAGATTGTGACGTACGACAACTCATTTTTTTTGCCTGGTGGCGCATGCAGTTGACTCACTGGCGCT
GTATTGTTTGTTTGTATCGTCTAGCTCGGCGTGGGCAACGGTTGCGTACATGAAGAACGAAGGCATCGCGGGCAAAGTGTACTTTGTGGGCGAAGCCGGT
CTCGGCCAAGAGCTCACGAACGAGGGCTACGAGGCGTTCGGGCTCGAGCACAGCGACATCAAGGAGCTGCCGACCCCGTTCACTGTCGACCACGATGTCA
AGGCGGTTGTCGTCGGTCTCGACAGGTACGAATGACATCGAATAGACGCATGAACTGCAATCTTGTGTGACTGACCGCTCGTGAATTTGCAGATACATCT
CGTACTACAAGCTCGCGTACGCTACGGTGTGCTTGCGCCAGATCCCAGGCTGCCGATTCATCGGAACGAACCCGTGAGTGGTGCTGTGTATTGCGTGCAC
ATTGATTCCTTTTATCACGCTTGCTGTGCACTGACCACTGTTTGAAACTGTGCTAATAGAGACCAGACTTTCCCAGTCGACGGTGCGATTCTCCCAGGCG
GCGGCACTCTCGTTAAGACCATCGAGTGCGCTGTTGGACGGTACGCTTCTATGCAATGTCACTGTCTTTTATAATAACTACATTGACCCAACACTTTGTT
CGTCAATGCAGTGAGCCAGAAGCGGTGATCGGCAAGCCATCGCAGGACTTGCTTAAGACCATCCTTGCGACCTACAACCTCAAACCTGCGCGCACGTGTA
TGGTAAGGAAACATATCATCACGCTCTTTATGTGCACCGACACGTGCTAACAATGTGCGTCTTTGCATGTGTGGCCTCAGGTTGGAGACCGCCTGTCGAC
GGACATTGCGTTCGGCCGCCTCGGTGGACTGCAGACGCTGCTCGTGCTCACGGGTGTGACCCACGAGTCTGAGCTGGCGAGCATCGAGCTGCCAGAGTAC
GTGCCGCACCACTACATCCAATCGGTCGACGTGCTCAACCAGCT