Description :
From Genome Similarity Track
Location :
scaffold_1500:411- 2787
Transcript NameFunction/comments
g11479.t1hypothetical protein

Sequence
2376 bases(100 bases per row)
CTCGGTCACCGGGCTCCGGACGACGACGAGATCGAGAACAATTATTTCGGGGAACAGAAGCTCATGGAGGGCGCGCTAATCAAGCTGGGGGACTACGCAC
ATTACCGGTACTTTCAGCTCTTTCGTAGTGGCCGTTTCTGCTACTACGAGCTGCCAATGCCAGCGGTGACGGCCGATGGAGATCGGAGAGTTCACCTCAC
GTCGAAGCACCTGCGAGGCTTCATGACGCTCCGTGCGTCAAGTCAAATCAAGAGTTTAGCCAGGAACGAGGAAGAATACGTGGCCGATCTCCTCAAACGC
GGACTCGTGTTCAACCGTAAGAAGCTCGAGATGCAGCTCACGGGGTACTCGCCTTTAGGCCAATTATTGTCCTGGAAGCTTCGTGCCAGCAGGGAAGCGA
TATATTTGAAGTGGGAGCGCGCATTTCGCATTGCTCTCAGGCCTATCTGGGTGCAAAACGCGACGCACTGTATGGTGTGCAAGAAGGACTTCACCTTCTT
CGTCCGCCCACACCACTGCCGGTACGGTAGACGATATAGCTACTCATTCATTTCAAAATTGACACGATATTTGTCTTTTTTGTAGCAAATGTGGGACGTG
TATGTGTGATGAATGCACCGTGTTGGCACCCCGGTTGCCATTGCAAGGCTACTACGATGAAGTGCGTATCTGTCGAGACTGTTCACCGATCAGCAGCCAG
CTTTCGACACTGAAAATGGGTACACGCGTCCTGGTGTACGGTATTTTACCAGGTCGCGTAGTGGACGTAAGTTTACCCGAAGGTGTTGACGGGAGGGGGA
CTGTAAGTGTGGAGCTGGTGAAACAAGACAATGAGAGACGAAGTTATGCCCTGGAGCGAGTTGAACTCTATTCAGAAGCGGTGCTATCGGCAAACCGGAT
CAAGAACGCGATACGAAGGCACTTGGCATACTTAATATTTCGAACGCGTCTCAATTTCAGCACGTGGAACATCTTGGAAACGATGCAGGAGCAGCGCACC
ATGCAAATGATGCGGTTCGTCAAGAAGTCAATGAGTATTAACGACTTGCACTCTATGATGCCGCTTCTGGGCTCACGTGGTACACTCGACGATGCCGTCT
TGGAAAGGGAGCGAGCCAAACTATCTCTTGCTCATTACCATGGAGTCCGAGTACTGTTTCCCTTGCGCCTGAACACAGTGAAGAGGCTGATCAACCAATT
TCGCAATGGAATCTTGCTCCATCCTGTGTTCGTACGTCGTATCTTGGACGAATCAGCGAAATTGTTCCAAACACAGCACAAATCTCCAATGAACTCGGTC
GACATCCCCCCAGGAGTAAAAATGGTTGTGGTGGGCGATCTACACGGACAGCTCGAGGATTTACTAACGATTATGGAGAAGAACGGGATCCCAAGCAGCA
AAAACTGGTATCTCTTCAACGGAGACTTTGTGGATCGAGGCGCCCACGGTGTTGAGATCATGCTGTTACTGCTTGCGTTTAAGCTGTTGTATCCCGGTTG
TGTGTTTCTAAATCGCGGCAACCACGAAGAGCGCATGATTAACGAGATCTTCGGGTTCCAGGATGAAGTTTACTCCAAATATGGCATTGAAAACGACAGC
AGTGCAGGTTGGGGAGGACTAAGCACGTCTATCAACTACTCGGCGATCAAGCTGTTCCAGATGTTCGAGACTGTCTTCAATTTATTCCCGGTCTTTGCCT
TGGTTAACAGACGCGTCTTCGTCGTTCATGGAGGCTTGAGCAACCACGAGAACGTCACTATCGCAGAGCTACAACAATTAGATCACCGGGGAGAACCTTC
ACAAGGCAGCAGTCGACAGGATGAACTTCTGACGCATCTTTTGTGGAGTGATCCGTGCGAGGAAGACGGCTGGAAACCTTCTAGCAGAGGTGCAGGCGTG
GAGTTTGGTCCAGACATCACCAAGGAATTCTGTAAGCGGAATGACATTAGTCTCATCATCCGGTCGCACGAGTGTCGAGAAGAAGGGTTTGATATCGTTC
ATGACGGGCTCCTTCTCACAGTCTTTTCGGCGTCTAACTACTGTGGATCGCAAACCAACAAGGGGGCGTGTGTGTTGCTGGAACGGGGCAAGAACAATGA
CATTCAGCCACGCGTGGTGCAATTTTCATCGCAACCACTCCAACAACTACGAGCTGCAGGGAGGAACGAGTGGAGACAGAAAGCTCGCCATTTAGAACGG
CAAACACTGGAGTCGGTCTTGAAGATTATCTGCGAGAATCGGTACGCGTTAACGCTTGCTTTCAAGCAGGCAGACACGACGAGATGTGGACGAGTGTCAA
AGATTGAGTGGAAGACAATACTGCAACGGGTGCTCGGCGTCCAAGCTAACTTTCTCTCGTATTTCCACCTACTAGC