Description :
From Genome Similarity Track
Location :
Scaffold_1911:411- 2230
Sequence
1819 bases(100 bases per row)
ACTTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATATTT
TAGCCAATGAGCGACATGCATAGCATTGGAATTTTGCCAACCAGCCGTTGGCAGATTCCTATGATAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTTA
ACTACGCTACGCTTCCTCACACACGTGCGCGCACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCGAA
CGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCATGGATACAGAAGTGCCCATGGAAAGCTCCACTACGCCTGCAAC
TCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATG
CTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCGACGCGATGTTGCTGCTACTACCGCGGTGTCGACCGGGA
CGACACCACGCGCGCAATCGCTAAAGCTCAGTATGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCAT
TGCGGCTCGACGTATCATCGACACGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGATGTGCTAGAAGTTGGGCGTATGGACGCCGACTCTCG
GGTCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGA
CCTGCAGCAGGGCAAGCATAATGTCCATGCCTACGCTCAGGGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCCAGGTC
GTCACGTTCATGAAGGGGCTGAGAGATGGACCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGG
AGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCG
AGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGCGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCG
TGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGTACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCA
GTTCCGCGTGTCGACCTTGGACACGCGGTACTGAGGACTGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGCCA
TCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGGAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCT
TGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTC
ACGTATGAAGATCAAGAGT