Description :
From Genome Similarity Track
Location :
Scaffold_3097:411- 2130
Transcript NameFunction/comments
Phypl_g15612hypothetical protein

Sequence
1719 bases(100 bases per row)
ACCGTGGACAACTGACTGACTTGTTTGAAGCGGGCGAACCCATCGATCCGGGTAAACCGTCAGTGCTGGGACGCCGATCATACATTGACGACATCCTGGT
GACTGCCGGATCGTGGGATCAGCTATGCGATCGAGTGGAAGTTCTGTTGAACGCATGTTACGAGTGGAATCTGTCTATCAGTGTGGTGAAGAGCTATTGG
GGGCTGAACAAAGTGGACTATCTGGTACACCAAGTGTCGCCTGGTGGGTTGGAAGTTCACCCGAACGACCTGAAAGCACTGACCGATCTACGCTTCCCGG
AATCTCTCCGATCGATGCAGTCGTTCTTGGGCAGTCTGAATTACTATAACCGTTTCATCGAGGAGTATGCGATCTATGCCGCAGTCCTGTACGAGCTACG
TGAGGTGGACTTCGCTGAACTACGAAAGCGGTGAGATCTCCGTCAGTTGCTGGATCGATCGTTACCTGATCGTGATCCCACGAGCCCCGACCCCGGGACG
CTTAACACGACCGGATCGGACCCCGTAATACCGGGATCGAAGGCCGCGGGTGAGAGATGGGTTCGAGCGCAACAGGCCTTCGAGACGCTGAACGCGAAGG
TAGTCACGACGCCGATCCTACGTCACTTTGACCCCGATCGCCAGGCAGTGGTGATTGTGTATGCCAGTGAGTGGGCAATCTCGGCGGCTTGAGTGCAAGA
TCACGAACACGTCTACCACCCCGTCATGTTCGCAAGTAGAACGCTCAAGTCGAATGAGTTGAATTAcaacgtggtggagaaggaagtATTGGCCCTCTTG
AGGATCTTGGATCTGAACTACAACATGCTGGTGGGACGTCAGATTCGGATCTTGACTAGGCATTCCACGTTGGCATGGCTTTTCAGATCGCCGGGGCTCC
AGGGACGTCTTGAACAGTAGGCCGCTCTCCTGTCACCTTGGACAATCGAGATCGTGAAGTGCGTGAAAGGGGAAGACGAAATCCTAGGGGCGATCGCGGC
GAGTATCACGCCCCGAtccaaggtggacgaggcgctAACTGCGATCGCACCCAAAAAGGAGCCACGACGTACGATCCAAGCACCGATCCCGACCGTGGGG
ACGAGCGAGGGGCTGTTCGTGGTGAGCTTTGATGGATCTGCCCGTGTTaagcgtggcggcggcgcttaTAGCGCGATCTTGTGGAAGTTGCCCGAGTGGA
CTGTCTTGAAGGCCCGATCAGGCTATGCTGAAGGGTTGACTGTGAATGAAGTGGAATACAACGGTCTCCTGCTATGTTTTGACCTGCTGGATGGGATGGA
TCAAGGACGCCTgtgtggtattgcagaacacacaaagtcgtcagatgtggatccaaacaacaaacacaacaatcgccgagttagtcggcgcttgttggcc
tgtgctgagttgcccccagcggttcggcccttccgggacagtggtgtctcgccttcgtcgagacctggcaaccaagtcaatcactccggaggtcagctga
gttcagctgcctccgttcctcccgtgccctccaccaaaggatggacgacggcgcgcgagcgctttTACGGGTCACCGAGAGCAAAGGCTACTCGGCTAGA
AGAGTAACGGTACCCGAGCTGTACGGTAtaccgactcgctggactcaGCGAGATTTGTTCTTCGTGCTTGGCGAGACACGCCCTTCCCCGGgccgacctt
gatctcttggcgctACCAG