Description :
From Genome Similarity Track
Location :
Scaffold_3258:411- 1922
Transcript NameFunction/comments
Phypl_g15724hypothetical protein

Sequence
1511 bases(100 bases per row)
CGTCCTTGATCCATCCCATCCAGCAGGTCAAAACATAGCAGGAGACCGTTGTATTCCACTTCATTCACAGTCAACCCTTCAGCATAGCCTGATCGGGCCT
TCAAGACAGTCCACTCGGGCAACTTCCACAAGATCGCGCTAtaagcgccgccgccacgcttAACACGGGCAGATCCATCAAAGCTCACCACGAACAGCCC
CTCGCTCGTCCCCACGGTCGGGATCGGTGCTTGGATCGTACGTCGTGGCTCCTTTTTGGGTGCGATCGCAGTTagcgcctcgtccaccttggaTCGGGGC
GTGATACTCGCCGCGATCGCCCCTAGGATTTCGTCTTCCCCTTTCACGCACTTCACGATCTCGATTGTCCAAGGTGACAGGAGAGCGGCCTACTGTTCAA
GACGTCCCTGGAGCCCCGGCGATCTGAAAAGCCATGCCAACGTGGAATGCCTAGTCAAGATCCGAATCTGACGTCCCACCAGCATGTTGTAGTTCAGATC
CAAGATCCTCAAGAGGGCCAATacttccttctccaccacgttaTAATTCAACTCATTCGACTTGAGCGTTCTACTTGCGAACATGACGGGGTGGTAGACG
TGTTCGTGATCTTGCACTCAAGCCGCCGAGATTGCCCACTCACTGGCATACACAATCACCACTGCCTGGCGATCGGGGTCAAAGTGACGTAGGATCGGCG
TCGTGACTACCTTCGCGTTCAGCGTCTCGAAGGCCTGTTGCGCTCGAACCCATCTCTCACCCGCGGCCTTCGATCCCGGTATTACGGGGTCCGATCCGGT
CGTGTTAAGCGTCCCGGGGTCGGGGCTCGTGGGATCACGATCAGGTAACGATCGATCCAGCAACTGACGGAGATCTCACCGCTTTCGTAGTTCAGCGAAG
TCCACCTCACGTAGCTCGTACAGGACTGCGGCATAGATCGCATACTCCTCGATGAAACGGTTATAGTAATTCAGACTGCCCAAGAACGACTGCATCGATC
GGAGAGATTCCGGGAAGCGTAGATCGGTCAGTGCTTTCAGGTCGTTCGGGTGAACTTCCAACCCACCAGGCGACACTTGGTGTACCAGATAGTCCACTTT
GTTCAGCCCCCAATAGCTCTTCACCACACTGATAGACAGATTCCACTCGTAACATGCGTTCAACAGAACTTCCACTCGATCGCATAGCTGATCCCACGAT
CCGGCAGTCACCAGGATGTCGTCAATGTATGATCGGCGTCCCAGCACTGACGGTTTACCCGGATCGATGGGTTCGCCCGCTTCAAACAAGTCAGTCAGTT
GTCCACGGTCGCCCGAGCGGGAGATCTTCATAAACCCATATAACGCGTTATCCGCCAGTCGCTGGTAGATCTGCGGTGCATTCTTGAGACCGAACGGCAT
TCGGTTTCACTCGAACAGTCCAAATGGAGTGATGAAAGCTGAgatcgctcgagctcgatcCGTCATCGTGACCACCCAAAACCCACTAGCCATATCCAAC
GAGCAGTACCA