Description :
From Genome Similarity Track
Location :
Scaffold_15:410949- 415967
Sequence
5018 bases(100 bases per row)
ACCACTGACGATCCAGTCGATGGCCAGATGCGTCCACAACTGATCCTTTCTGTCACACACGCATAAAACAGTGTTCATCATCAGAAGATGGCCAGACGAT
GACCAGACCAGTTGAAGCAAAATTTGAGAATTGGATTGTAATACGGGTAACTCTAAATACACCTACCTTTATTGCTGAATACACCTACATGATTCGTAGG
TTATCCATTTAACTTAAATAAACTATGCTGACAAATACTGAAAGAAGATCCGCTTTTTAACAAGAGAACGTCCAATAGTTAGCCTCAGTCAGACCTCTCT
TTCCGTCTTCGTAACTTTATCGTCTACATGATGATGAGCCATCATATCTTCACCTCTGGCGGTGCAGCTCACAAAGTAAAATATTCAGTCGCTCCTACAT
CGGCCTCCTTTGCTATTCTTGATACTGCTATTAATCAATCCTTTCACCCCGGCTCGAGAAGACCCCTACCGGTCGGTCCATTCGGAAGTCAAGAGGAAGC
TGTCCGTACCGTGAAGCGGTATGCTGTGCGCCAAGGTTTAGCTGTCAGCATTGTTCACACAAGATCGCGCGGCATAATGCGCGTTCTTCTTTGTTGCTTG
CAAGGAAGACTATCGTAATTCAACGGGTGGTTGGTGTCGTTGCTAGACCGCGGAAGTAAAGTCGTTTGCAGTTTGTGTGATCTCGCGATCATCTTTATCA
AGAACTTGCGCACCATTGAGCCTGGTCGACACTTTTAAACAACTGTCACTTTAGACTCACCCGACGCATGAACAATACCGGCGGCGCGGCGTGTGTCACG
AGAAGGAGACGGCCGCATTTGTCCAGATGCATCAATCTGTAGCTGCTGCACAATAACTTGCGCGTATGTGATAATGTGAAAATACATTTAACACGTGCCA
TACCTATTTTTATTTCAGGGTTACTGAACCACCTATAGGAGACCAACATCATTACGAGAGCAAAGTGATGTCCACAACCACTTCCAATAAGCTATCTTAA
CGGCTCTGCGCGTGAGAACGAATCCAGTGTCTCCACCAAGACCGCGATGCTTTCGCCTCCATCCTTTTTCGTACAGAATCGTCCGACCTACATAATGTCG
GCATGCTCTTGCGTTCGCTAACGGGCAACCCTCAAAACTGAAAAATGAAAGACAATGGAAGGTTGAGAATTCTCCTAAATGAAGGAGGTCACAGTGTAAC
GTTAAATCAACGGGGGGCTTATATAAAATAGATGTTCTCTTGCTAAATTGTGGCTGTTCTCTTGTTAAATAGTGGATGCTCTCTCAGCATTTGTCAACAT
CGTTTATTTAAGCTAAATGGATAGCCTATGAATCATGTAGGTGTATTTAGCAATAAATGTAGGTGTAATTAGAGTTACCCTTGTAATACTCGAGACATGG
TCGTGGTCTCATCTATATTTCAGTGTATATCGAAGGTCGTCGATTCAAAAAGCTAGCGGGAACATGTTGTGTATACAATGTACCACAGTTTCCGTCAAAA
TTTTGAGCCGGACGTAACGATTAGAGCCTGATGTGGTGTCTGGCTATATAGTAGTAAAACGTGAACGTCGATTAAGTACTTATGACTATACGAAATCGGT
GTGCTGCTGCCTAAACTACATCATCTCCTTCTCGCTGGCTCAGTCTGCTGGCTCGACACTTCGGTCATCACGGGGGACATTCCGCAGGGGGCACGTAGAA
TCGGATATTCAGCCCGGGGTGCAGACAGGGCGCTGAAGTCGCGGAAAACGCCAGGTACTACACCGATCACCCCCGATGGGCCGCTGACGCACCTGGACTG
GGCCGATCATAATCACGTTCTAGGCATGTTCTCTTCATGGGCTCGGGATCGTGCTCGGCGACCGGGCCGGCTACTCGAAGGCAGACGCCGAATAGTAGGA
ATTAGGTGGGGGTGAAACTATGCCCTTCACCCCGGCGTGTCTTGGTTGTTGCTCCCCTTTCGGTTTGCACGCTGCGCTGCCTCACGTAGCGAAAGCAGCG
GCAAGAATGCCTCCTCCTTTAATCTGGGCCCCACGATAGGGGACTTCCCACCTAGGGTAGGGGAGCCGGTCGCTCGGCTCTATAGAGGTCTTCATCGCTT
GACCGTTGTTGCCCAAAGGCGCAAATTGGGAAGTGCGTCTGGCTATATGGATTCGCGCCGAAGCGAACCAAGCAGTTGTTAGGCTACAAACATCTATTTC
GAATCACGCGGATACTTATTGGCATGTCTTGCCGTACTACTCGCATATTCAGCGTACTGGTGCCATATCGACTTTACATGAAACCAGTAAGTAAATTATA
TCGTCTGCGCAGCGATGTGGCCATGAGAATGCACCATAATGGGCTAACACGAAGCTGTGATAATTGTAACGAGGTGTGTCTGCTACTGATATTTTACATT
AGGCCACGGATCGTGACACAATCCTTCTGAATCCTAACACAGTCTGTTGAGATGTGACCAATTTATGTAATTATATGATTTGTCCATTTTTGTAACAAGA
GGGATGGGGTTAAACTCTAAATACAGATAAACCTGGCTAATCTGATCCCTGAGAAATATGAAATACTGCTATATATGGGTAGGTGCTGATCCACCAGTTT
CGTTATAGTTTAAATGTATTGTGTATACTTGATATTGGGCAAATTCATAATTAATTAGTTGTTTTGTCGGATATTAATGGTTATTGCGCCGATGTGTGGG
TCAGTGTTATGCGCTCGACCCTTCCGCGAAACTGGCATCGGTTCTAAACCTGCCTTCGTGCATTTCACAAACAGTTTCTTTTTTTGGAAATGATTCCAAA
GCCAAAAAACATGGCAGCGTTCTGTTGGTTGAAGGTGACGCGGCTATACAAAAAGGTGTGTCTGTGCTCTGTAGTACTCCAAAATACTCCCTCCGTTTCA
ACATGTTTTTCCCTATTCAGGAAAATAACAGAAAATTAGCTCATTTTTAGAGCCTGATTGGCTAAGCGCCTCGATATAAAGCTTATTCTATGCTCTTTCA
GCTAGTGTTAGTCACGTACTTTTCCAGTAGCCGCAAACCGAAAAAATTACACCTGAAAACCCATCAATTATGAAAGTTTTGATGCTGAGGTCGATTGCAA
AGCGTTTAAGCCATCGATTGTCAAGTGTGAAGGCTTAACAACAGCTTAAAAAAGGGCGAATACCGCTATTTGTGTCCGGATTTCTAAATCGCCTGTAATA
GATCGTTATTGCATCTTAAAATAGACGCGCATTTTAGCTAAAATCAGACTAATTTGTCTCTATAATCAGTTCAAATCCATAATTTGATATTATTACTAAT
ATCAGTTAAAAGAATACCATACTATGGCTTCCATATATAGGCTATTATTTTACCTTTATAAATGTATTTTGCCACAACGGACAAACAAATTTAAAACGAA
AAAAATGCTCGGTTTGGGACAAAGACACTGGAACAGCGGGAGTAATTGTTTTCGTAATATAAATACGCTCATAGCTCAAGTGGGTTAATGTGGCAGCCCC
AAGCATTGGGCACTAGTTCGAGAATCAGGAAGTGCAAAAGTGATAACGTTAAACCTTCGGATCTTGGTGTGTGGGGTTCGACAGAACTGTCCCCAGGCAG
TGAAGTCCTCCAACTTTCATGGTGTAGCCCATCAGAGATAAAGAGAAGAGCCTTTTATATCGCATCATGATCGACATGATGCGATATAAAAGGTCAACTA
TCCAAGAAAAGCATCAAAATGGTTATAAAGCTTTGACACACAAATCAATTTACTTTTGGTTTTACTACTTTAGCCGCAAGTCTGACCTCCGCCTTCTACG
CTCCTTTTTAACAAGTTATAAGCCTAAGCGTCAACTCGCGTTCGAATTGACTTCGTTTAAGCGGAACCAGCAACACGCTTTGGGCGTACAAGTGGAACAT
GTACCTCATGTCGAACGGCCTATGAGATGTTGTGAAGGGCGGGTCGATTTTGACAGCGGTTATGAGCAGATGTGGCACGCGGCGATCGTGCTCATACTAA
GATAACACGTTTAGCAATGAAGGTTTTTAAAACGTGCTATCAATATCACTTAATCATCGTCTCATCATTATTGAATATTTGTGCCGCAGAGGAGAAGCCT
CTAATTAGAGTCTGTGTGAGTGACCGTTCCTTTTCTAGCCTCAAATCCATACGCAATCGCTTTTTTGCTGCTGCAATGTACGCATCCCGCCCATCATAAT
TCTCTCTAAATCTGGATGGTTCTCTAGCAAAACAATGATGGATCAAACTGCATCTACTTTTCCCTCGGCGCTTATCTCTGGCTGCGTGTTGATGACGTCT
TCGTTCGTCGACTCCGTAAAGTCACTGATATCTTGGGCCTTAAATAGGATTTTGGCGTCCGCTTCTTCTCTGGCAGTCAGGGCTCCCATCTCTGTGTAAG
GCTTGGCGGTACAGCAAATGAAGTCACTCAGATCCATCGGATCGCGGATGCACAGCTGAAGCGTTTGTGCCAGCAGGCTAGTGGTTCAGTTCTGTACCAG
CGTCATATGAGAGTGGCCGTACGGCCAAGCACTAGCCCTGTGTGCCGAAAGAAGTTTCGAATGTCATCGCTCGGAAACTCACTCCAGCAGATTTTGATCC
ACTTCATCTCCGTGAGCTGGTCTAGCATGTAGATGTTGGCCTGCGATCCTTCTTTCTCCACATACAAAGAGTGGTAAAGCTGGTGGTTTAGATATAGACG
CTTGGACGATGCGATAATACCGGCGTCCATGGGATGAATCTCGCGGTCGTGTTTGGCGGAAGGAAAACGATAGTCACGCTCTTCAGCTCCATTTCTTAAG
AAGTTTGCGTCGATGCATTGTTGAGGAGGAGAACGATGTTGCGTTCTTGAGTGCGCATGTCACTGTCAAGATCACCCATCCACTCTCGGAATAGAATACC
TGTAATCTGCGCCTTGAAGATTGCTGCGATAGTAGAAGCCAATATGACCCCTGTCTTCTTCTGAAAAAAGCGCGGCTTCTTCGCAATAATAATGACATAC
GGCTCGCGTTCGTTTGAG