Description :
From Genome Similarity Track
Location :
Scaffold_114:41094- 46233
Transcript NameFunction/comments
Hyaar_Emoy2809952reverse transcriptase

Sequence
5139 bases(100 bases per row)
CCATACCCCGTTATCGTTGAATTACGGGGTATCGTGATCGGGTTCCTCGATCAGCGGTAGATGTGTACCCCTGGTCAGGTCGAAGAGTCAGCCTGATCAG
CGTGTCGAAATTTGAACTAGGCCTGTTTTTTCACCACTATATGAAGCCTAAAGGATAAATATTTTCTGTCTAGCAGGGTAAGATTCGCACCCCTCCGTAG
CCCTCTTGGTCATCTCAGTTGATCACATCCACCAAGATCAACCAGTTTTACGATCAGCAACCGTGGGGCGTGTACGATCGGATCGTACGCCCGATCTCGT
TCAAGTCCTCCGGGTTGTTCAAACAACTGTTTGACGCGTATCATGGTTTCGTGGATTGCAATCTCCAAGCCCTGTGGGAATCGACACATTTCTTGTGTAT
CCCCTCTGCGCAGCGTGAAACGGATCCTGAGTTGGCCGCTTTTGCAAGAGCACGAAGGCAGGGACGATCTCGTGCTGGCCCTCGTTGGAAGAGGGTACTG
CAGCTGATTTTTCAGGGTATGATCGACGGTCTTTGCGATCTGGACATTTTGCTGGATCCCATGTTCCTGCACTTTCCCCGTCCGAACGAATTTAGGGTGT
GGTATCCCCGCCTGTACGTGCAGCGGACCAACATACCAACTTGATCACCGCTTTGTCGATCGATCATGCTGCAGAGTGTTGGAAGAACCATTTCGCACTT
CGATCGCCTCCCACCCTGGTTCATCTCTTTTACGCTTGGTTGTTAAGTCCTTTTACCACGAGTAGTCTCTTTGGTATAGTCCCATACCGCGATCTCTCAA
TATAATTTCACCTCACTTCCATCCGATCGCTTCCATAATTCATTTCCTTCCCTTATTTTTAATGTATTTCGTTGTGGTTGTACCCCTTGGTCTGCAATCT
TCCTTTTCAGTTTACATAAATTCCATTTCATCTCCATGTACAGTCTCCTTGCACCCATTACTCCCTTCCCCGCCCATACAACTTTCCTGCATTGACACAT
CCACTCAAGTTCTCCGATCATCGCAAGTTTCTGGCTCCTTCTTCGAGCAATTGCATAACCTCAAAACGATTCCTGCTCGCCCGATCGCGATCTAACTCCT
TCAAATAGATCCACAATTGAGATCAGCTTCGTCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTGTACCAGTAACTGCTTGTGTATTCGGCCATACCTA
GTCTTCCGTCCCAATCGCACATCGATAATCTTATCAACTCCAAATTCGTCTGCGTCAAGATCACCCTCCGAAATATCTTCCGGCAGCAGCACTTCATCAA
AATCGACTCGACTCGCCTCATTCACATTCAGCCTACTCTTAGGGCGTTCTGAGAATACGCGAACTAGCTTCAACTTTGAAACGTAAACCATTTAAAAAAG
CCAGTATGGCGTACCCGCAATTTCCAACCTTACGGCGTGATCGCCGCGCTTTTCGGCCACTCGAAAAGGTTCATGCCACATATGGGCTAGCTTCCAAGCG
TATCCTTCCTTTACTTGGTCCAGATATAATTAAACTCGTAACCCGCAATCGATGTCCAATAAATCTAGATCTTCAGTATGTCGATCGGCTCGACCTTTGA
TCGCAACCTCCAATCGGTCATTCACTACTGCCGGTGCACGCTGGTATTGGCGTTGTATGCCATATCTTCACCTTAGTACGTCTCGATCTCGGGGTTTGGT
GCTTCCCAAAGGTAAGTTGCTTCCAGGGTTGATTTTGGGTCCCATCCGTAAATTAGGTAAATAGTGTGTCTCCTCGAATTCGATCATGAGCGGTGTTGAT
CTCATAGGTCAATCGCTTGGCGTATTCGTCCCAGTCCTTTTGATTTTCATGCATGACATACATCTTGATCGATCGAGTCAGTTTTTCTGGACCATGCGCT
TGGCCGTACCATTCGCTTGCGGTCTATATGCCATGGTGGCTCACTGTTTTTCTCCCACAATACGACTGAAGGCTCGGAAGAAATTGGACATAAATCCTGG
CTCGCGATCATAACGTATAGACTCACTCGCACCGAATCGTCTGAACACGCATTCCTCGTAATTTTCTGCGTCGTCTGTGCGGATCTGGACGAGCTTGCTT
TCGCGATCACATACCCCGAAAATAGATAGGCCCACAGTCAGCTCGGTGTTTCTTTAAAGGATCGTGGCAACGAAGGGATGTGATCCATAGCTATAATCTG
AAACGGGTACGTCGATTGTAAATAACCAGGTGATCTACTTCGATTACCTGGTCATCCTTTTCTTGTTTCACAATCCACACACTCTCCTACATACCGCTGC
ACACTTCGGTACAACCCACATCAATTAAAGTTCGCCCTGATCGATTGATAAGTGCGGCCAATTCCTTGATGACCACCCTCTAAACTTGTGTGGTAATGGT
GCAAGAATTTTTGCTGTAACTGCTCTGGAACAACCAGACGAGCCAGTTCAGTACGGTCCTCCGATTCGGTTGCCGATCTCGGACAGAAAAATAGCCATCC
ACTTTGGTATACTTCATAATCTGGTGTGATCAGGGCGCAATCTTTGGCTTCAGTCGCCGATAATCTAGCCACATCTCCCACCAGATATATCTTCGGACTG
GATATTCCATTTTCTTCGTCTTGTGCTTGCTTAATGCGATCGACCCGTGTCTGCTGCACAACTGGTTTTGCAAAATCCTGGTCTGGCATCGTCTTCTTAG
GGCTAATGGAGTGATAGCCGCCACTTCGACTGCATGGTCGACTCGTTCTGGTATTAGTAATTCGCTTAATCGATTTAAAGTGATCAGATCCTGACAATCC
TGATCCGAAATCACAACTGTTCCTTCCTCTTGCCGTAGTGATTAGCTCGCCAGCATATCTACACTCTGATTCCAATTACCTTTTATATGCACGAATTTAT
GATCTGGCCACGATTGAAGTTTCTCCATCGCTCTATGTCTCAGCAATTGTAGTCCTGGTGCCTTACAGTCAATTTATCCTTGCATTTGGCGGATCACTAA
ATTTGAATCTCCGCACATAATCACCCGTTCCCTGGCCTGACCGGCAACCAACATGAAGATAAGGAGCAACCCTCGGTATTCTAATTCCTTCACGGTCAGA
TCAGGGGTAAACTCGGAAGCAGCCGCTACAGTCGTCCACTCCGGCAATTTCCATATAATCGCACTGTATGCTCCGCCTATTATTTTTACCCTAGCCGACC
CATCGAAACTGGCTACTAGCAGATTTTTATTCACTCCTACCGTTGGTGGTGGCATATTTATCATCTGTCTTGGCTGCTTCTGCGGGGCGACCGCAATCAA
TACTTCATCCACTTCTTCACGGGGTACTATACTCGCAGCAAATGTGCCAAGTATTTTATCTGCTCTCTTCTCAGATCCCCGAATCTCCAACGTCCAGTTC
AATAATGAAGCAGCTTCGAAATCTTCGTTAAGACCTGAAGATTGTAACAGCCATGCAAGTGCCGAATATCGTGTAGGCACTGTGATCTCGCGGAACACTA
TCATAGTATAACAGATATTTAGCATCCGGAGGAGAGCTAACACCTCTTTATCCACTATCCCGTAATTGAACTCGTTAGGCTTTAGCGTACGACTCGAGAA
AGTGACAGTCCAATATACACTGTCATATTCCTGAAGCAAAGCCGCTGATACAGACCACTTACTAGGTTACACTACGATCACAGGCGATCGATCGGGGTCG
AAATGCTTTAAGATCGGTATTGTGGCTATCTTAGCCTTTAGCAACGTGAATGCAATCATTGCTTTCTCCCAACGACTCCTACCCTCGGAATCGCGATTGT
CCCCTGCAATTGGGTACAGATTGACATCGATCTCTACTTTTGGCTACAGATCGCGATTATTTCCTGCAATTGGGTACCGCTCATCATCGATCTCCCGTTT
TTGAGTATATTGCATTTATTTATCTCACATCCGTCGCGACTGTCATCAGGTCCTACCACAGACATAGGTTTGGAGCTCCATTAGCGCGGCTGATATCATG
GAAGTTTGCTTCACGTACAACACTGATGCGTAAAATTCGAAGTCTTTAATAAATCGACTGCAGTAGTTAAGACTTCCCAAAAATGAATGCATTGATCGCA
ACGTCCGAGGAAACGAAATGTATACCGACGATCCCAAATCTTTCGGATTAGCTTCCAAAACTGCGAGTGAGATTTGATATCCTAGTTACTCTACCTTGCG
ACGTCCCTAGAAACTTTTGGCCAAACTGATAGACGAATTCCACTTATCGCACGCTTCCAATAATCTCTCCACTTTCTCACACAAGTATTTCCACGATGTA
GCTGGTATCAAAATGTCGTCGATATAGGATCTTCAACCCAACAACGATGGTTTCGGATCAGTATCTGGTTCACAAACCGTGAAATCATCGATCAGCTTCG
GTTATTCGGCCGTGATCGATTCGGATCTTGTGCCGATTTCCAAATATCCATATAGAGCTTTATCAATAAACCGTTGGTAAATCTGTGGAGCGTTTTTAAT
CCGAAAGGTATCCGTAACCACTCAAACAACACTGATGGTGTGATAACAGCGGAAATTGCTCTTGCGCATTCAGTCATTTCCACCACCCAAAAAACACTCA
CCATGTCTAGGGAACAGTACCACATAACTTTATCCATGTCCTTCAATAGTTCACTGATCAGAGGCATGAGTATACCATCAACCTATTCAGCTGGTTCACC
CTCTTTTAATCAATACACAGCCTTATGTCTTCTCCATTTTTTTTGACGATCACCACTATAAGAGACGCTCATGGTGATGTAGATGGCCGGATACTTTTGG
TCGACAGTAATCCTTTAATCAGATCGGCGAGTTTTTTTCGATATTTGGGAGCCACATGCCTGACCCTCTGCACGACCGGATTGGCCCCACCCACATCTAT
ATTACAAACTGCTCCACGCGCCGCAGGTGGTACGGCACTATTTTTTCCAATCAGGAAATGGCGACTCCACCAAATCACTTGTAGCAACTTCTCTTGATCA
TCTGTCGTTGGGACGCCTGGATCACCCACTTGGATCTCATCAATCGCTATTCTTGCGTGGGCGTACCAACTTCAGGCAGAACTGCCATATGCTGATCGAC
ATCTTCAGCGAACAATCGCCGCCATCGCGGTAGTATATC