Description :
From Genome Similarity Track
Location :
Scaffold_237:4109- 9446
Sequence
5337 bases(100 bases per row)
CCCGTTACACGTGAAGCACTTTGTAGTCCGTCCAACGACCATAAACATGTTGGATGATGAAGGGATAACTTCCATACCACGCATGAAAGCTACTCCCATT
TGAGTCAAATCGAATGGTATGTCGTCGAACGTTTGAGCTCGACGATAGGGCAAGAAGCCGTCGGCGCAATACTGTCCTCTCTGGGGCCAGACAGACAGCA
CGCCACCATTTCCACGTTCATCCAGAATGAACTTGACGCTGAACGGGAAAAGGTAACCTTGCTTCATTAACAAGGTTCTCAACAGTTTAAACTGTTGAGA
CAGCAGCATGCCGCTGCTACCGGGTCGATACACACACGTCGACCCGAAACATTGAAGATTGACATCTCCAAGTACAAGGGAGTCGATGAAGACTCCATGT
TGATATGGTTTGTGAAGCTGGACGATGCTATAAGGGCTCGTCACATAGTCGATGAGCACATGCAGGTCGCATCTGCTCAATCGAACTTGGCAGGACGTGC
GAAGACTTGGGCCTTATGCCTCAAGCTACACGACCCATTTGTCTTTGGGTCGTTATAAGTCTTCAAGTCCCTGCTTAGGCAAACATTCTAACCACCACGA
GCTGAGTCAGGGCTCGCTTTGAACTCCTGAAACTCGAACAAGGTAAACGTGATGTACACTCGTACATTTAGTACATGTGTCAACTTACAAGTTGCAATAC
GTCCAATCCACCGAATGAACAAACGTTGATCACGTTGTTCATGCAGGATCTCACAGACGGCCCAGTCAGGACCTATCTCTTCCGGTTGGAATCTGGTACC
CTGGGAGAGGCAATCCGGGTTGCGGAACAAGAAAATTTCAGCGTGAAACAAGCTCACGTGAGTTCAAATTCCCATCGTCCCCTGAGACGACGAGGACCAG
AACCGATGGACCTCTGTTACGCTGAGAGGGAAAGCTTTCTCTTTACCAATTATAAGAAATTGCAGAGATGCAATAGATGCCAAAAGACAGGGCATTATGC
ATACGAATGCAGTGCCCCGAACGCGGTGCCCCGAACGCGGTACCACGTACCGCAGGAAACAGTAACAGTCAAGCGGCCAAGAAGGGTCCAAGGCGTGGGT
CCGACGTTGTTGCGAAGACGCAATATCGTGACGGACGACCGAATAACGGTCGGAGTCAGTAGGTGCAAATCATCTACTGATCCAGCAACGTCAACTGAAT
TTGCAGGCCTTTTGACGAGAATTGCTCCCGACACCCAATCATTGTGTGCTACTGCATCTGGTAATGAGGTTCCCCTCATTACCACGAGTCGAAATGACAA
ATGACATGTCACTACGAGCCCTGGTCGATTGTGGGGTGTCAAACAACTTTGTACGACGCCAATCGCTAGACAATAGCAAGCTTAAATTTATTGAGCGCGA
GATCCCTCCAACGAGGATAACGGTACGCCTCGCTACAGGCGCATTCGTAACAGTGATGGAGCGTGTAGTGAAAATTACCTATACACTGAAAGAAGTCCAA
TGTAATGGTGACCTCATCGTATTGGACTTGGATACAAGTTTGATGTCATCCTTAATTTACCGTGGATCAGAAGGTACGAGCCACAATTCAGCTGGCATCG
ACGAACAGTCGATATGCCTGTCGCTTCTTCACCAGATGGTCATCTGATGAACGTCATGGAGCGCCCACTAGCATGTGGGTGTACTACGGGTGAGTGCGAT
GGCCTCACGTGTGGTTTTGTCGTTAGTACGACTGCACATGACCACAATGTGACTGATCATCACACTGTGGAGCAAGATTCCGGCGATTGCGTAGAAACGC
AGGTGGCGCCGAAGGCCCAACACCCATATAAGTCGAGCGGACCGGGGCATGGTTGCCTCCTTAATAGACAACACCCAGATCATGACCAACCGATTGTCAA
TGATGGTCAATACGGAGATGGAATAGCCCAAGAGGCTAGAGTTGAAAGACTAAGTCCCCAACAAACAGTGGAAGTAAGTTCCCATGAGATGACCGAGACA
TTGAATGTCCTGGTCATCTCATGGAAACTTACTTCTACTGTTTGTTGGGGAATTATTCTTCCCCGAAATTAACTTCGGAGATCTCTCAGTTACCCCCGCT
AAACCAAAAGAGGTTCTTGCGTGATCTGCGTAGTGTCAAATTCAAGCAGATCTGCGTTCTCGTCGCGGAGGATGAGTACGTCAGTGATATCCGATCGCTA
ATGGTCTTTGCCGAAGATGAACGAGTTCTCAGTAGCTCATCAATGGACGAGAGTTTCCTTGATGAGAAGACTGGAATTGAGCGATATACATCCCAATCGT
GGGAATCGCTCAGAACAAATCCTCTCTACGATGATTTGATGGAATTCAGGGATGTATTCCCAGAAGCAGTCCCGTGCGAGCTACCTAAGGACAAAGGTAC
TCGTCACGAAATTGACCTGAAACCGGGTCTGAAGTACTGTGTCATGAAGCAATGGCCACTGCCTTATGAACAAGTACTATCAATCGACAAATTCTTTGCA
GATCGCTTAACCAGCCCGCCATGTGATGGAGTCCACCTCTCCACATAGATCTCCCACCTTCTGTGTGCGACAGGCCAAAGGAGAGTGGCGGATAGTACAC
GCCTTCAACAAGCTGACTGCTGCCACTGTACCGGCTCAAACAGCAATACCAAGGAAAGATGTCATCATAGATGGTATAGCTAAGAGTACCATCTTTTTAT
CCATGGATCTGATGGATGGGTTCTATTAGATCCTTATTCGCGAAAGGGACATTCCCTATACTGCAGTGAGCACCACAAGCGATATGCTCTGGGAGTGGCT
GGTGATGCCACAAGGATTAATTAATGCCCCTGCCCTATTCAACAGATGTGTTTCAAATCTGTTGAGACCAGTAAGAGCTTTGCACCCAGTTACTTCGATG
ATGTGTTCGTCCATAGCCCGGCTATGGATGGAAAGACGAATGTGGAAGTCCACCGACTCCACGTCCGGAATGTTCTTACACTGATGCGCGAGCATAAGTT
GTACGCCAGCCAACCTCAAGAAGTGTATATTTGGTGCTAGCAAAATACCACTTCTTGGGTGCATCGTGGGCAAGCATGGCGTCTGGCCCGATACAGAAAA
GATCAAGGCGATCACCGACTGGCCGGTGCCTACAGAAGTCAAGGGACTTCGAAAGCTCTTTGGCCTAGCGGCGTATTTGCATAAATATTCACGCAATTAC
GCCGAGATGACTGTTCATATCTCTCTCTCGTCTATTGATAACGAACAAGAAGTGGGTATGGAGTGCTGATTTTTAATTTTCAGCGCTCCTTCGAAAGTAT
CATGCAGAGCTTGATACGATCGCCAGTTTTGTCGATTGCAGATCAAGACATATCATTCCACAAGTCGGTGACGCCAGTGACTTCGCAATCGGCTGTGCAT
TAATGCAGTACGATGCAGATGATGTGGCGCGTGTCGTCTGTTACCAGACTCACCAGCTGCAACCAGCTGAACGCAACTACCCCTTCAGTGACAAATAACT
CCTTGCCATGAAGTACGCGCTGGTTAAGCTTAGAGTCTATCTGCTAGGTGATAGACGCTTCATCGTTTTTACGGACCATGCGTCTTTACGCACGGCCGGA
AACAGTCTACTCCTCTTGCAGTGGATGGCGAATGGCTGTCATTCTTTGTGAAGTAAAACTTCTCCGTCGAGTAAAGGCCAGGACGACTTAATGTCGTCGC
TGACGCACGCTCGCGCCGGCCCTATTTCGATCCGGCTGCGCCACCCGACACTGGTACGACCACTGTCGCGGTACTGACTTCGAGTGTCCCGTCGTCAACC
TTATTGGAAGACATAAGAAAGGTGTATGATCTGGAGATGGTGCGATTGACTTATCATCTTGCAACCATCCATGAAGAACCTCAAACAGTTGTCGTTAGTG
TATCGATCCTCTACGGATGGATGTACAGTTCGCAACAACTTACTGAAATATCCAGCTGCTGCCGGCGACACGCCTCGTGTCGTCGTACCTGATAAGATGG
TCTGCGGTTGCGCATCGTGGATGAGCACCACGACGCACGTGTTGGTGGGAATCTGGTCGAGAGAAAACATATCTCACATTGAGCCGCGACTTCTACTGGC
GCCTCCAGTATCAGTTCAGCGCAAGTACTTTCGTGCTTGTGGGGCACGAAGTTTTTAAAAGGGTACAGTCTAGTCCTTCCCTTCGCGCCCCGTTGCAGCC
TCTGCTCGTCCTAGCAGAGTGCTGGAAATCCGTTTCCATGGACTTCGTCTTTTAATTCCCCGCAGACTCTCACAAGAACACTGGTATTCTTGTGTTCATT
GACCGATTCAGCAAGATGGTACATCTGGTTGCTGTACCTGCATCAATCAACGCATCGGCTTCTGTCCGTGTCGTTATCAAAACGGTCTTTCGCCTTAAAT
GGGTTGCCTCGTGAACTCGTGTCCGATCGGGACCCGCGGTTCACAGCTGAGTTCTGGTGTTCCGTGTTCAAAACACTCGGAACGCGCTTAAAGATGTCCA
CGTCTGTCCACCCTGAAACAAATGATCAGACGTGACGCGCCAATCGTATTCTCGGAGAATTACTTCGAGGGTATCTTCAATATCTTTCAAATTGGAGCGA
ATTCTTGCCGATGTTGGAATTCTCCATCAACAACTGGGTGCATGCGTAGAAAACGCATACACCGTTCTTCGTGAATGACCTGCGCCATCCGCGTCATCCC
ACCTTTTTAGAGTGTGACTCTCGTTTAAGGGGGGGGGACTCAATCGAGCGACCGTCAATCCGGCTCTCACTCATCACGTGCTGACAATGCGGCCACCACG
TTCGACGCCGATGTCGATCACATCGGCTTTGGTGAAGAAGATGGAAAGTAAGAGCGAAGATGCTCTTACTGGCCACGATGCTGATCAAATCAGCACCACG
CCTAGTGTGTCCAAAGACACGCTCACAGAGGCGACAAGTGATCTTGCTACAGTACGCTGCAAGAGAACTGCAGCTAAAGACAGCGAGTCAGCAGATGAAT
TAATTCTGGCTAGTGAAACGGTTGTCCGTTTCGTACAAGACTTTATTGCAGAGGCGGTAGATCGACAAAAACGAAACGCTGACAAGAATGGAAGGTCAAA
CGTTCTTTTATTTAATAAAGGCGACTTAGCCCTACTATCTACGGTAAACCTACCTTGACACATAGTGACTAACGTGGGAAGTAACAAGTTACTAGCCAAG
TTCATCGGTCCATTTCGTGTGCTGCGCCGCCTAGGCAACGCGTATACGATTGAACTTCCACGTAAAATGCGCACGCATCCTACACTCTACGTCGGTCGCC
ATAGACCGTACTATCAGTACGAGACTTCTTCTGGTGA