Description :
From Genome Similarity Track
Location :
Scaffold_227:41079- 43682
Transcript NameFunction/comments
Phypl_g5622oligopeptidase A, putative

Sequence
2603 bases(100 bases per row)
TCGGCGAGTCCGTATTGcatgagcagcggcaccacggACGGCTTGCGCCCGCGGAAGGCCTCGAACACCTGTTCCGggtgctggccgcctccaCGCGCCA
GGATCGTGTCGCGGAACTTGCGGCCGACgcgcgccgcggcctcgggactctccttggccgcctcctcgaAGGCGCCGTAAGCATCGCACGACAAGATCTC
GGCCCACTTATAGCTGGTGGCAAGACATTGGTAGGCAGATCGGCGTTAAGAGAACGTCCGCTCACTGTTAACACGTTGCACTCTGCAGGGGACGTACCTG
TAATAGCCGGCCGCGTAGCCTCCCGCGAAAATGTGCGCGAACGAGCACAGGAACcggtcctcctccagcgggCTCAGCACGGCGAACTCGcccagcagac
gctgctgcgcggcgaaCAGCGACTCCTGCGATGGCGAGTAGTGCGAATGCAGGTACATGTCCAGCGCGCCGAAGcccagctgccgcagcatgACTGTGGC
CACCATGTAGTTGCGCGCcgacttgagcttctcgaacagctcggCCGGCAGCGGCTCGCCCGTCTTGTAGTGCCCGCTGATCGCCGCGATCGTGTCTGTG
AAAGCAAAATAGCGACACGGTAGCAGCAAGGTTGTTAGATTACGTGTCCACTACGCATCTATCGCGGCGGACGCACCCTTGTCGTAGCAGAAGTTCTCCA
TCATTTGCGACGGAATTTCGACGGCGTCCCATTCAACACCGTTAATGCCCGCCACGTCACCATACTCCATCTGGGTGAGCATGTGCTGCAGACCGTGGCC
GAACTCATGGAAGatcgtctccacctcgcggAACGTCATGAGGCTCGGCGTCTCGCCCACGGGCGGCGACTGGTTACAGATGATATAGGCCACAGGAATA
CGCTTGCCGCCCTGATCCTTGGGGCCAAGCAGGCGACTGCGGTCCACGCACGTGTTCATCCAAGCACCGccgttcttctccttcggGCGCGAGTACGGGT
CCAGGAAGAAACGAGCAATCACATCCTTGTCGCcctcggcgctgcgcacATTGAAGAAGCGCACATCCGGGTTCCAGACCTCGGCCTGGCCGTCTGCGGC
CTCGATGGTCACGCCAAACAACCGCGACGTCAGCGAGAACAGACCATCAAGCACCTGCACAGGAGCAACATCAAGCAGAACATAAGCCATCTCGAGCGAA
GACACAATCAGTTGCACAAGACAGGGACGTACGCGCTCGAGCGGGAAGTACGGCTTGATTTCTTCATCGGTGAACAGGtacttcttcgccttcagtTTTT
CAGACCTGAAAATGCGTAATGAATAACACAGATTAGTAAAAGCGACCGTGGTGCGACGGTAGCCATCGCATGCGTACCAGTAGCCAAGATCCCAGGGCGC
GAGGGGCTCCGTCTGTCCGTGCTGCTTCGCGTACTCGGCAACAGTGTTCACCTCGTCGTGGGCAATAGCAATGCACTTTTCACGTAGGTCGGTGTGCATC
TTTTCAACTTCCTCCACGCTTGGCGCCATCTTTTTCGAGATGCTCACCTCCGCGAACGAGTTGAATCCAAGCAGCTTGGCAATCTGCTGACGgatctcga
gcagctcaatgATGATTCCTTCGTTGTCAAAAGACTCTCCACTCGCGCGGGTCGCGTACGCGCGGTAGAGCGTCTCACGCAACGATCGGTTTGCCGAGTA
CTTCATGAACTGCACGTAAGACGGCGGGTCCAACGTTACTCGCCACGGTCCATTCTCAGGCGAGGCTTCCGAGTGGCCCTCATCGCGAGCGCTCTGCGCG
aacatctgcagcagcgaaggAGGCAGACCCTCAAGATCTCTCTTGTCGGTGATCGTGATCGAATATGCCTTGGTAGCATCCAGCAGGTTCGACGAGAACT
TGGTGCTCTGCAGTTAGCGGCAAGCCAACACAACAGTCAGAACCCCCAAAAACAATGAAGCTGGTATCCAGTCTTACCAGCTCGGCCGCACGCAGCTTGA
GTTTGTTGAACTTCTCCTTCCCCTCGCCCTCCAGTCCGACGCCACTGAGCGTCGCGCTCCGTAAACCGAGCTCGatgatgcgctgctgcgccagctcgag
tTTGCTCCActcgtcgctctcgcgcACCGCTAGGTACGCGTCGTAGAGCGTCTTGCTCTGCGAGGCCTCGGTGACCGTCTGGAtcaccagctgctgcagc
ttgtcgtgcACGGaccgcagctcctccgaGTTGCGCACGCTCATGAGGTGGCCCACCATGCCCCACATGCggcccagcgcgtcgcccTGAACCTCCAGCg
ggtccaccacgtccacgaaTTGCACGCTCTTGCcggcctcgcgcagcttcgtctccagctcgcgcaggttgCGCGTGTAGTCGGCGGTGGCGTTGGTGAC
CGCCGGCTCGATCTctgccagctgcaggcgctcgaAAGGCGGCAGCTGGCGTTCGCGCACGCAGGACTCGAGCGAGTTGGCGGACGCGGACGCAAAGCTG
CGCCAGAACAGCGAGGCGCGGCGGGAGGCGGCGCCGTTGGACACCGCGCGCAGGGGACGCACACAGCGGAGCAGCATGATGCAAGGTGTCGATGGTGTCG
ATG