Description :
From Genome Similarity Track
Location :
Scaffold_501:41073- 48837
Sequence
7764 bases(100 bases per row)
TGTGTTTCAAACGCATCCAGTGTTGGATTTCATTCTCGTTTTTGACAGTCAGTATCTTGATCTCGAAGTAAAACGAGGATTTTACCATGATAACTTCATT
TTAATCATGTATAAATCATGGGTCAGGATTTTTTACCGTATCTTTCAGTATCTTCTCGTATCTTTCCGTATTTTTCCAGGAAGGGTACTGAGTTAACATA
GTATTTTAGTGTCCAGGATTAATCCTATATCAATACCTGGATATTACCATGATAAAAATCCTGGACCGCAACAGCTGCCCTTTTATTTTGGGTAGTTGAA
ATTTATGTAGATTTGCCCGGTATACCACTGTCTGAGTTTGCAGCCAATGTTGACTATTTCCCAATCAAAGTTGGCTGATCGTTTTTTGCGCGCAAGCTCA
ATGCTTTTTTTGCGCACGAAAGTCTCCAGGACCAGCATATGCGAGCTCTTCTCAAGCTCTCATTTAGCAATTCGACATCTCCCGCGCAGATGCCATCCAA
GCTCACCCCAAGCAGCACTCACCGGAAGAACGTCGTCGCGTTCTGGAAGCTTACAAGGTCCCAGATAATTGGCGAGCTGTAGCACATCCCAACGGCTTCC
CGCGTACGACAGCTCAGTACCTTGTGAATAGCGGCCGTGTCAAGGGTCTGCCTCGTGGTGGTGCACGACGACGAAGATGACGCCGCAGATCAAGCAGGTT
CTGGAAGAGTACCTCAATGAGTGCTGCTCCTACACGCTTAATACTACGAAGGCCGTCATGGACAACTTCCGCGTGGGTCTCTCTTTGGCGACGATCTCGC
GCCACCTCGTGGGCATACTGTACACTGTTAAACAGGTATGAGTTTGTTTTGCACGAATATATTGACGAGATGACGCATCCGCTTAGCGACCGAGGCAACG
ACACAAAAACCTCCACGACTGAAGCGCGCCGCCCACGTCTGCATGCGCACTGTGACGGGGTCACACAGCACCTTGCACAGAGGAAGTGCTTTAGGGTATT
TACTACCCGAGTGGATGTTAGTCTACGTGTTCCCGGCCACAAAGGGAAAGGTTTGCTGCTTAGAAGAGTAGATGTAAGACTGATGTATTTATAGGTAAGA
TAAGCTTGGATCCCATACAAACTAGAGGTTACCTATAGTGGAGCTAAGTAGTCATGCCCTGACTGGCTCCGAGAGCATCTGGTATCACGTACTAAGTGTC
CACAAGAGTGACGGGTAACTCTTTATGTAACCTGGGGTACGCTGGATTGTACCCCGTTACATCCTCCCCCACTTAAATGAGAATCACCTGATTCTCCAAT
CGCAACTGATTCTCCAATCAGAAGTGAGAGAATTAAAACACCCAAATGTGAATTCTCACACTGAGCAGCCATGAGACTGACGCGGCTCTCAGTCACACCC
ACAGTGACTTGTGCTTCTAATCTCACTGGGATTTGCATCCCTATGCTCACAGCTGTGTTGGCCGCAAAGCCTACACTCAGAGCTGTCTTAGCACTTGCGC
TAGCGCGCGTACAGTGCTTTGGCATAGGATGCAATAGCATCCGAACGTGTGGCATTTACCCACAGGTCGCATCAGAGGACACGACAGTCCTCGCGAACGC
GTCCGGAGCATGGTGTAATCCGCGAGGGACGACACCGTAAAGGGCAACACCTACCCAGCACTAGAGGGAGTTCTCAGCTCACCGCGGGCCATGCCTTTGA
CTCCAGCAAGGATCAATCCTTGCGGGCGGAGCTTCTGCCACGCTGTCTTCGCGTCTTGGTCACCATACCAACGGCGCGTAGGTGTCCTTCATGGATACCG
TGTACCGTGATGGTACAGAACCGTGGTGTTGGTGTCTCTCATCGACACCATGTACCGTACGGTACAAACCTTTGGTGCGGTATGCACACCACAAGATTGT
CATGTTTGGCGGCAACGGTTTCTGCTGTGCTGTCGCCTGAACGGATTCAAGGCCAGTGCTTGTATCATGCACGACACATGTGCAAGCACAGTGTACAGGT
CCATGGGTCCGTTCACGAGGTACGCTGTGTACGACACGTACCACAGCTACCATAAGTGCTCCGTGCACTTCATGTGTGTCTTGCACGACGACGTGGAACT
CCCGGCAGGCGGCTCGGCAGCAGCCAGCGTATACGCCCAGAGCGCATCGGGTCGTGGTATGGTGCATATCCTTTGCAACTATACCACTATCTGTCACAGA
TATCATGTACCTTGATGGTACTTGACCGTGGTGGGGCATATCCCACCACCATGCCACTACGGCGCTGGTGTCTGGCATTGACACCGAGTACTCGTGGGTA
CCAAGCCATAGCGAGGCAAGCAGACATCACCACGGTGTCATGCTCGGCGCGGCACCAGTTACGACTGCGTGCGTTGCCTCGACCACCACCTGGTCAGTTG
TGTGTGCACTCGTGCACCACACTTGGGTTATTGCTCCACGGCCCATTATACCCGGCGCGTTGCGTACATCACGTATCGTGTAACGGGCCAGGTATTTACT
CCGTTACTTGCTTACACTATTGTGTTGAGGAAGCTCGCAATAGGACGACTAAGTCTTAGGTTTAAGGAAAAATCAACTCTGACTTTATTGTAGGACCAAG
GCCACAGCCTTGGCCACTCAAATACACGCCATAGTCCAATTTGTGAGATGCTATCCTGCTACTGTGAAATGCTACTTGCTACAGTCTGCCAGTGTCCAGT
GCCCGACGTCATTGCCACGCCCAAGACACTGGCAATACCAGTACTACCGATCCGACCTACAGTCCTACGCATGTCTATGCATGTACTGCATCCCGGCGTA
CCGGGTCTGCAACGCGCTCACGTGCGAGCTGCGTGCGGTAGATACCAAGGACTGTATGAAGGACGACATTGGTGGCGGTGAGCAACTGCAACTGCGTTGC
AGGTGATGGTGAAATACTTAGCTTTCTATAGACTATCTTAGGTTGAGTATGTGCTAATCTAACTTTGCGGAACATGGAGGTTCAGGTGCTGGCAGCTCTC
ACTCATACAGCTGCTGGTGCTGCAAACAGCGAGTGAGAGGCAGCAAGCACCAGAACTCCGTGGTCCTGTCGTGATACTTTGCCCGGCACTCACGTGTCTT
ACATTCTAATTCCTATTGCTCTACGCCTACTGCCCTACAAGTCTGTGCCAATGGCACCTACTCTACGTAGTGATAGAAGGTCGGAGAGCCCGGTGACGCG
CCATGCGTCATCTCAGGTTATGAGCCCAATCAGGGCGCAGCTATCGGCTGACGTGAACTCTGGTGTGGAAAACACACAAGAAGAAGTTTTGACGAATCAA
GGAGAAGATTCCCCGGGATTGGTCGAAAGACTGAATGGCGTGGATGATGCGACATTATCGCAATCGGATGCTGAGCGACTAATTTGCTCATTGGTCGGAA
TTACGGGTGGGCGCCCGTTTCTACGAGTGTTACTCGAAGGTATGCAGAATTCGAGCACAATCGAAGGAACGGAACCAGTTGAAAATCCGCCCCCTCCGCC
ACCGCCACCGTCGAGCCAAGGATCTGTTGGCAGTGGACGAAGCTACACGAGCCGAGGAGAGAGCAGCCTGAATAACATGAGCCCCGGTGGTCGGTACGAT
GACAAGGAGCTGTCCGACGACACCAAGGCGTTGCGCAGCTCTGCAAGCGTCGTGTGTGCCTAAGCTTCATAAGAAAGAAGACTTCAAGGCGTGGCGAAGT
GAGGTGCCGTTGCACTTCGAGACGCGCTCGCTCGGCGACATTACGTATGGAGGAGAGCGATATGACGAACAGGAAGGTCTACGTCGCCCTAAGTATCATG
AGTGGTTTGCGACGCGAAAGAACAAGGCGTTCTCTGCGTTGGCCCTATCTCTATCTGTGGACTTACGCGTTACGTTCAAGATCAATGAGATAAGAGACAA
CATGGATGCGACAGCAATGCTGTATTCAACGATTTTTAAACCCTTTGAGGCTGAAGACGGCATCAACCCTGACTACTTGCTTCAGGACTTGGTGACTCGT
CGATTACAACCGATCGAGTCCGTTACTGCGTACGTGGAGGACATCGGACGAAAGGTGACACTCCTGCGTCAAGGAAATAGTGATTTTGAAGAATGGCAAC
ATGCAAGCCTACTTCTATCAAACTGCGTGTTGGTATTTCGTGATCTCGCGCGTGGACACGCAGACTGGACCAACGAACATGACCGACGTGGCCTAAAGCT
GTCCGAGGCATTGCAGCGCCTGCGCTCCGCTGAACATCAGCGCGATCAGCTTCAACAGCAGACGAACAGGCCTACAACGCGAACGATGCAAGTCGCGCAG
GTTGGTACTGACCAAGGCCAAGGACGAGAACAAGGTCAAGGCTACGGACATGGACATGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCC
AACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCG
GGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTATCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCA
CTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGCCTTGCGGGTGT
ATTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTGAGAGCCTCTAGGGTGTAACCGACCAAGTAGTA
AATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGAT
TCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGATACTGTGCAAATTGAGTTCTGTA
TTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGAC
CCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATATATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTG
GATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCGTTGTCCCACGAAAG
TTCGAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATACGAACTCGGAAGTATGGGATCCGG
GGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGAGCACCGACCATCCTTCCTTCATAGGATCCACACTCGATC
CACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCAT
ATCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGCCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCCTTTGAAATTG
TCACTGATTCGGGATAGTGACCCCGCGTCAGGACCATTCTCTTATTTCTGAGAAAGCACTTCACCACAATCGCCTCCTGTACGTGGTCGGCGCTGCACAA
CAGCGTCCACGACGTGCATCACCAGCATCCACAACCGCTTTCTCCCCTTCGCGACACATGTCTCCCGCCAAGCGTACCGGCAAATCGTCGGGCAAGGCCC
CATCCACTACACCTCCGGTCAGTCCGTCTTCCATGTCGCCCACCGATCTGCGGGTTCTAGCCCAGGCTCTTTCCGATCAGGTGCAAACCCTGACGGCGGA
GCTCCAGACGGCTCAAGATGCCCAAGACCAAGCTGCGTCTCTACACACTACCCAACTTCAGACCTTGCGGGCCCAAATCCATGACCAAGCGATGGAGATC
CAGGGGTGGGAGCACCGTGCGACCTCTCGGTCGCAGGACCTGCGACTCCTGTTGGCTGATCAGGCGGTCGAGATCCGCGACCTGACCGGACGGCTGGATC
GCGCCTCCCGTCAACGAGACGTTATGCGAGATGACAACGACCATCTCCTTAGGGAGATGGCACTCGCCGGATCTGAGATCCACCAACTCCAATCCCGGAT
CCACGACCTCGAGCGGGACCTGGAGAATTCCCAGACTGCTAGGGCAGCTGCGGATGTGAGCTTGGACCGCCTCCGTGACGAGTTGCGTTTGACCCAGGAG
GAGGTGGTGACCAACGACTATGTGGGATCCGCCCATGGCGGATCCGCCTTAGGGTCGGCGCGTGGAGGGTCCCCCGCGCCAAATCCACCTCCCTCGTCGC
CGGATGTAGCCCTGGCTCAACTCTCTGAGGAGTTGCAAGACACCAAGGAGTCGCTCGAGAGGGCGTCTACCGGACGAGATTACGCGCTTGAAGAATTCGT
GCGTATGACTCGATTGCGGGACGAGATCCAAACGAAACTGGCAGACAGCGAGCTCCAGCGGGACAAGGCGACTACCGAGTGGGCGGATGCCGAGCGTGCG
CTAACGGAGCTGGAATCCAAGCTTCGCCGCATGAGTACGTGGATCCTCTTTTAGCCCTTGCTAGTGACTCCATATTCACTTGTTATTGTCCATCTAGGTG
ACAAATTGAAGAAAGCAGATGCGACCACCGCGAAACTCCAGGATCAACTTTCCGCAGCCCAAACTCAGCAGCAACAGCTGATCCTGGAGCGCGATCGCGG
CCTGTCGGAGCGCGATTTGGCACGTCGACGACTGGCGCTGGTGACAGCTGCCGTCTCGGATCCACTTCCTCCCTTGTCGGGGCCCTCTCAGGCTGCTAGC
GTTTCTGCTCCTCTTCCGACGGTAAGTGGGACGGATTCGTCGACTGCGAAACGCCCGCGTAGTACATCTCCCGCTCCTAGCACCGGATCCTCCCGTCCCC
ATAAGCAGGCCCGAGCTTCCCCGAAAGCCAAGCCCAAAACGGCTCCGGTTTCTAAATCGGCTCCGCAAGCGGGATCCACTTCTTTGTCCAAGGCAGGATC
TACACCCGCGCCCAAGACTTCTGTTTCTCCCTCGAAGTCAGGTGCCGGATCCAAGTCTGGATCCACCGCTAGATCCAAGTCTACCTCGGCGTCCAAGACT
GGACCCGTTGCTACGTCCAAAACGGGATCGACGGTGTCCAAACCGGGATCGACGTCCAAGACGGGATCCACCGCTGCTGCGTCAAAATCTGGATCCGGAC
CCAAGACTGGGTCTACGGCGTCCAAGGCTGGATCCGTTGCCCCATCCAAAACAGGATCAGCGGTGTCCAAGTCCGGATCGACGGCCAAAACGGGATCTAC
GGCAGTATCAAAATCGGGATCGGCGTCCACGACGGGATCCACCGCTGGTCCTTCGGTAACGACGCCCATCGTTCCTCAGTCTGCTTCCACCAACCCTCCG
CCGGCCCGTACTGGACCCGGGAAGGGGAAAGCTAAACGCGTCATTCCCCCTGGGTGTGGACTGGGTAGTTCGGAGGACGATGAGGATGAGGACTCTGACT
GGTCCGACGGCTCAGGGCCTCCTAACCGATCGTCGTCAAAGCGTACGCCGTCTGCCGGCCCGTA