Description :
From Genome Similarity Track
Location :
contig_32:410711- 412161
Transcript NameFunction/comments
g7354.t1ETO77287.1 hypothetical protein F444_07486, partial [Phytophthora parasitica P1976

Sequence
1450 bases(100 bases per row)
AGCGGCTTCTTCCAGACGACCTTGTACTTAGTACCAGTAGCCGTTTCCTTGCGGTCCGAGAGATACGCCACAGGCCACGTCGTGGCTTGAGTCTGCTCCT
TCGGCGGCGGCGTGGAGCTGACCTGCACCTGCTTCTTAGATAGCGTCCGTGCGCTGACCTTCACCTGCTGCTGACCTGAGCGCTTGCCACCACATGACAT
CCTGTCCACCTGCAGGGTACGCGCCATGGCTGTTCTGGGCTAAAACAACCCCGATACAACCAAAACACACACAAAGCAAGTAAGGCAAAAGAACAGTGTA
TTTAAAATATACTGCCTCTGCCCTGGATGCCAAAAGTGGAAATGAGCACCTGCATGCAGGCGCCGGCGCGAGGTCTACAGAATGCTTTTCAAACACCGTA
CTGGATTTAGTGTGCGACACGAAAAGGCAACTTGTGTGCTGTGACCGATATGGTCACAATCAATCTGATGACGTCCGAAACGGACTCTACAAACTAATGA
CTATGAAAACTAATAAACTTTGGCTACCAGGCCTCATTTGCAAACTTGCCGTGTAAGGCGCACTTGGCCCGAAGGGCCAAATGGCAGTTCATGTCCCTCA
ACGAGGAGAGCCCAAATCCGGCCTCCGATGAGCTCTAGGCGTTCTACAAGCGCCAGAAAACGCAAAAAGTTGTTTTCGGCCACGCCGTTTTGTGAAATTG
CACGATCTGACTGAACGAGTTTGCCAGGGATGTGCAACCCAATTTTGACCAATAATCTCCATCCCTGATGGCGAGCCAGGGAGGCTGTTGAGGTTAGGCT
CGGCCACCTCGTGACTCAAATAAGACATATATTATGCATTACCGGAGTGGCTATCTGAAAGGCAACTTCCACTCTGAAACGGTTGGCAATGGCCAACCTG
TACTATGTTTTTGGCAGCAGTATAGAGTTTTCTAGCTTCGTTGTTCTTCTAACTGCTCATTAATGCTCACTATTTCTTTTACCATTCTCCGTACAAGTTC
TGTCCTTCAAACGCTAAAGCTGCCCCCGCAACATTCTTGAGCTTGGAGAAGAGCAGATGACGCTTCAGGAACTCGCCAGCCCGGGTGATTGCAAACGTGG
CAGTAAACCGCTTGTGGCTGCTACCTCCTTCCGCAATAACACCTCCCTGGCGCCCCGGGGTGCAATAGTTGCGTTGGGCTCGGTCTCAAAGTATCTCGGT
ACTTGGTCCATGTTTATTATGTTGCACGATTCGATCCGGTGCTCATCGATCAGACTTTGTCCGTCGTGGATGAACTTTAGGCACACCTCCTTGGCATATG
CAGAAAGCGTCCGCGTGGTTGTGTGGCGGCGCGATACAAGATTGTAGCGGTTCTTGAATTTCGACAAACCAGCCAGAAGAAGCCCTGAAAGTCGGAGGCG
AGGAGCCCGATGAGTCATTTTCAGCCAGGCTCCGGCTGATATTGAGGGCT