Description :
From Genome Similarity Track
Location :
contig_32:410700- 412150
Transcript NameFunction/comments
g7710.t1hypothetical protein

Sequence
1450 bases(100 bases per row)
TTGCCACCACATGACATCCTGTCCACCTGCAGGGTACGCGCCATGGCTGTTCTGGGCTAAAACAACCCCGATACAACCAAAACACACACAAAGCAAGTAA
AGGCAAAAGAACAGTGTATTTAAAATATACTGCCTCTGCCCTGGATGCCAAAAGTGGAAATGAGCACCTGCATGCAGGCGCCGGCGCGAGGTCTACAGAA
TGCTTTTCAAACACCGTACTGAATTTAGTGTGCGACACGAAAAGGCAACTTGTGTGCTGTGACCGATATGGTCACAATCAATCTGATGACGTCCGAAACG
GACTCTACAAACTAATGACTATGAAAACTAATAAGCTTTGGCTACCAGGCCTCATTTGCAAACTTGCCGTGTAAGGCGCACTTGGCCCGAAGGGCCAAAT
GGCAGTTCATGTCTCTCAACGAGGAGAGCCCAAATCCGGCCTCCGATGAGCTCTAGGCGTTCTACAAGCGCCAGAAAACGCAAAAAGTTGTTTTCGGCCA
CGCCGTTTTGTGAAATTGCACGATCTGACTGAACGAGTTTGCCAGGGATGTGCAACCCAATTTTGACCAATAATCTTCATCCCTGATGGCGAGCCAAGGA
GGCTGGTGAGGTTAGGCTCGGCCACCTCGTGACTCAAATAAGACATATATTATGCATTACCGGAGTGGCTATCTGAAAGGCAACTTCCACTCTGAAACGG
TTGGCAATGGCCAACCTGTACTATGTTTTTGGCAGCAGTATAGAGTTTTCTAGCTTCGTTGTTCTTCTAACTGCTCATTGATGCTCACTATTTCTTTTAC
CATTCTCCGTACAAGTTCTGTCCTTCAAGCGCTAAAGCTGCCCCCGCAACATTCTTGAGCTTGGAGAAGAGCAGATGACGCTTCAGGAACTCGCCAGCCC
GGGTGATTGCAAACGTGGCAGTAAACCGCTTGTGGCTGCTACCTCCTTCCGCAATAACACCTCCCTGGCGCCCCGGGGTGCAATAGTTGCGTTGGGCTCG
GTCTCAAAGTATCTCGGTACTTGGTCCATGTTTATTATGTTGCACGATTCGATCCGGTGCTCATCGATCAGACTTTGTCCGTCGTGGATGAACTTTAGGC
ACACCTCCTTGGCATCTGCAGAAAGCGTCCGCGTGGTTGTGTGGCGGCGCGATACAAGATTGTAGCGGTTCTTGAATTTCGACAAACCAGCCGGAAGAAG
CCCTGAAAGTCGGAGGCGAGGAGCCCGATGAGTCATTTTCAGCCAGGCTCCGGCTGATATTGAGGGCTTGGAGCTGAATATATTTATCTTTGACACGAAG
ACCCTTCTTGTTCCTGCTTTTCACCCAAGCATCCAGTCGTTCTTCCAACCGCTGGTGCTGCGGCTACTGTCCAGCTCCGGGAAATCGACGCATCACACGA
GCGCAAGCCTGTCAATCCTTCGAGACAGCGTCCATCTCCTCTCTCTTGTT