Description :
From Genome Similarity Track
Location :
Scaffold_404:4107- 6085
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_404-abinit-gene-0.31Myosin

Sequence
1978 bases(100 bases per row)
TCGAAGACCTCACGAAACTCGTGCATCTACATGAACCGGCGATCCTGCAAGTGTTACGGCATCGGTTTTTTCACGGACTTATCTACACCAGTACAGGCTC
CATCTTGGTCGCGCTCAACCCGTTCCGACGACTCGACCTCTATTCAGAAAGCATCAAGGAAAAATACTACAAATTGGGAGCCGACAAGGAAGCCGCAAAG
CAACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGGCGTTCCGGACGATGCTCTCGGTGATGCGGGACAACAAGGTGAACCAGACTAT
TCTCGTGAGTGGTGAGAGTGGTGCTGGTAAAACTGAGACCACGAAATTAATTATGAACTACCTGGCTTACGTCTCGACTTGCCGAAGCGCAGCAGTCAAC
AAGAGCAGCGCAGCAAAGGGCCAACCCACGATCCATGACCGTGTGCTTGAGTCGAACCCGATCCTGGAAGCCTTCGGTAACGCGCGTACGAACCGCAACA
ACAACAGTAGTCGGTTCGGAAAGTTCATCAAATTGGGGTTCACATCGACGGGTGAGATGCTTGGGGCTCAGATCTCGACCTATTTGCTTGAACGGGTTCG
ACTTGTGTCGCAGGGCAAGGGCGAACGTAACTACCACATTTTCTACGAGCTGTGCAAAGGTGCTTCCAACGAAGATCGTGATGCTCTCATCTTGCGGGAT
GTGACCGAGTACAAGTATTTAAATACTTCCGAGTGTTACATTCGACTCGACGGTGTAGATGATGCGAAATCGTACCAAGAAACTCGTCACGCGATGACGA
GTATTGGCATGGACAACGACGAGCAACTTCATGTGATGAGAGTGGTATCCGCAGTGCTGCATTTGGGAAATATTCACTTCGTATCAGAGAAGGGCAGGGA
CTCATCGACAATTGACTCGTCCTCCTCGTCGCTTGAGAGTCTTCAAGCAATCTGCAAGCTTCTTGGCGTCGAGCAGGAAGTTTTACACAGCACACTGTGC
ACGAAACAGATCAAGGCAGGCGCCGAGTTTATTACGACGAAATTGACAGTCAGCCAGGCCACTTCGACACGTGACTCGGTTGTGAAAACGCTCTATTCCA
ACCTATTCAACTGGCTCGTGGCGCGCATCAACAGCTCGATTCAGTACAAAGAAGAGCGAGGCAGCCAATTTATTGGTGTTGTCGACATTTTCGGTTTCGA
GATTTTTGAAGAGAACTGCTTGGAGCAGCTTTGCATCAACTACGCGAATGAGAAGCTGCAGCAACTCTTCGGCCGGTTTGTGTTCCGCATGGAGCAAGAA
ACCTACGTGTCTGAAGATATTCCATGGCAATTTGTGGATTACCCGAACAACGATATCTGCGTGACGATGCTTGAAAGACGACAAATGGGTCTTTTCTCAC
TTCTGGATGAGCAATGTCTGATTCCAAAGGGTAATGATGAGAAGCTGGCGAACAAGTATAACGAACAGTTGCTGAAGGAGTCGTCGTATTCGGTCTCGAA
GTTGCAACGAGCTAAAGGTCAATTTGTCATCCATCACTACGCCGGTGATGTGTGCTACAGCACGAATGGTTTCTGCGACAAGAACAAGGATCACATGCAC
ACCGAAGCGATTGATTTGCTGAAAACATCAAAGTTTGGATTCGTCCGTTCAATTTTCGAAAGCGCGGATGGTATGTCATCTCCAACGGCCGCGAAAAAGA
AAATGGACGACCGAGGCAGTGACACTCGCCGTCGATCTGGTATTATGTCGTCGACAGTGGTCGCTCAATTCAAGAGTCAGCTTACCTCTCTTCTCGAAGT
GTTGAACGCAACCGAACCTCACTTTGTTCGATGTATAAAACCGAATGATGTTGCAAGCTCGGCTGTCTTTGAAAAGAAGCGTGTGTTAGAGCAACTTCGG
TGTAGTGGTGTTTTGGAAGCTGTGAAGATCTCGAGAAGCGGGTACCCGGTGCGGTTTGTGCATGATGTCTTCATCAAG