Description :
From Genome Similarity Track
Location :
scaffold_14:410608- 413005
Sequence
2397 bases(100 bases per row)
AACGCTCAAATGCTTCCAACTTTGTACTTCAGTACCAATTCAATGCTCAAAACAGGTGTCATTTACCGCCGCAGTGATAGTACTGTACTCAATGAGAGCT
CGGAGGTCGAATAGTTTGTAGCCTTAACGAATACAGCAACGCTTCAGCGACAGTGTATCTAGAACCTTAGCGGAAAACACGTATATATACTATACCAAAA
CCTTTTTTAGTAGTTCTTCGGATGCTGTCCTTTTATGCAGGACAGTTAGTGTTaacaagttcagggtcctaTAAGGTCGCAAGGTCAGAATCAGATCCCG
AAAAGAAAATAGTTAATAACTCCTAGAAATTGATATAGCAGGCGCTTCAGCTTGGACCAACAAGCGCAGCCAAATGTAATTGGACAGATTGAGTAGTATC
TACTTGCGCTGCTAGATGCGAGAATTGACTTAGTAGGTGGCAAAATGGAAAGTACCGTAAAGGCAACTTGAGAGTACTATAATTCTCTTGCtctttttaa
tttttattATCCAATCATATGTAACAGCATATTTTCACAAATGAGCAAGAATATTGTGCCCTGCCGATAAATGATCAGTCAAATATTTTTCTACTTATAC
TGCGCTGTATTCATGATGCGCAGCATTAGACCTGTGCAAGTAGCATAATCGTCTCGACAATTTAACCAGACGAAACAATGGACAGCCTATTACGAAGCGC
TCTAAATTCTAAAGGCCAGCTATTTAAGCGATTTAATCGACATTCTTGATAAAAGAGGTAATACAGGTCGaaaattttattttgctTTAAAGCCACGAAC
TTAACGACTCAGTTACCAGCGCAGCATCAAGGAATATTCACTGCCATCAAAGTAACAATCGTCTATGCCCTTTCAATAGGGTAGCAGGTGTTATAGTGAA
CCTTCCGGTAGGACAACGCGGTGTAGACGTCATGGCGATTTCGGGCTAGGACAGAACAAGTTTTAATCCAAGGTAGTAATATATTTCATGATATATGGAT
TACAAACCCATAGAGTCACAAGTTTTTTTGGCAAGAATCAGCTCTTAATGCTGCGCAGCATCTGTCATTGCAGTTTGTTTGAAAAGAACATATTTATCAG
AGGACCTATATCACTATCTCAATGCTTTTGATCTGTCTAAATTCGAGGTGCTGCTAGTTCAATTCTCACGATTTGTCTTTACGAGAGTCCCAAGAAAACG
GCAGCTGGTTAGACTTAACGCCTTTGCTGTTGTTGCCATTATATTAATCAATTTTGTCTGTACGCCAAGGGCAGCCTTTTGATCTGGCGATACTTGTCAA
ATTACATTGGGAACTCTCGCCGTTAACTAATGAATATTTCAGCCAAATAGTAATCTGTGCCATCCTTGCCGAAAGTGGGGTTGCAGGAATGGGAATCCCA
TCAAGCATTGAAGTCCGGGTATATCATTTAATACGTATAGCATTCAGATTAAGGTAAACATTTGACCTGTCACCTTCTTTTTATATAAATATTGTCGCGT
CACTTTAGACGCCATTGGAACAGGTCGAATATCATGATGAAACGTAAAGAGTAATCCACAGCGCTGTAAGAAAAAAGGTCTTCTCTGTGAcgtcaaaaaa
tatttatcgtCGTGAAGATCCACAGATCTAAAATTGTTTTTAACGATATGAGTCCCCCCTTCTTTTCCGAATGGCAATGATTACTCAGGATATGTCAATG
ACTTAAGCTGCAGAGGAACTCCATCACGCAGATTGTTTCTGACAACCATTAGTCTTATCACGTCCATTGTCCGAATCTCTTCATCACTGACCTGTCTTCC
TCCGAGAAGTCCACCAAAATGAGCGGCGCTTTTACAATGTCCGATAGTTTCAAATTGCCTGTGTATCCTCCAGTTTTCTCACATATCTTTTGGTAAGCCA
CGCGCCGATTGTTTGTAAAACTGGCTTTGTTCAGTTTCTTTTTACTAAGCGCGTCTTCAAAAATTTTCCCATTTCCGTCGATCACCACATCAACGAGCTT
GATGTGATCGCGCACAGCTTTAAACACATTTCTATCATTTCGCTAGAAATAATGACAAAGTGATGAGCATTTACTTGATGccaaatgaagatgatgatga
tgaaggtcAGGTATATTGTGTCACATATAGATGAACGACGATATCCTTTCACCTAGCTACACCATCCAAGACAGCTGAGACCTGCAACCGAACATTTGGA
GCCAGTATTGTAGGTCTTGGTTGAGGTGTTCCGCAATGGCCTCCCAGTTTGGGTGAGAGGTGCTTGCTTCGCATTGTTGGGATNNNNNNNNNNTTTTACG
CTGCTAAAAGAGAGCGCCTTAGAACTCTGAAGCACTCCAAAGTTAGTTCCAAATCAGAACCAATGGCACCTCAAGTTGCACCATATACATCCAAGGC