Description :
From Genome Similarity Track
Location :
Scaffold_115:41058- 42672
Transcript NameFunction/comments
Phypl_g3467conserved hypothetical protein

Sequence
1614 bases(100 bases per row)
GCGGCAtggcgcagcgagagctcctgcacgacctcgtggagcgcagccgcgcgcgcgtcgtGCAGGTGCGGGCGGGCAGCAGTctgctccacgtgctgca
tcagcagcagctcaacacGTCGACTTcactgccgcagcttcctccagcCCCGACACTGGCGATAGCGCCCAAGCGCCGAGGAGGCAAGACGCTTCACCAT
GCAGACCAATCAGACGGAGGCGGACACAAAggccgacggcgacgtgacGCTCTGCCGCGACTTGCCAAGGACGTCGCCGTGCAGCTGCCCgaggccacga
cgtcctTCGAGCAGTACCAGGACTTCATGGCCAACAAAATCTACCGAAAGGAGACCTCACACCTGCTGAACCGCCGCCCCGCGCTCGTCCCGAAGGCAGA
TCtcttgaagaagctggccacgGTCTGTGCCGGCGCTCTGAAGGAAATGGAGAGGGAGGACGACGCCTCAGCGGTGCGGGAGTTGCTACGAGAAAAACTC
GTGCGGGCaatgacgctgctgcagggagGATGCGCCTTTGCAAATGCGAAATCACtggcaccaccgccaccgcctgccTATGGGGAGATCAAGAACGCCC
ATTTGGCCTTCCAGCAGTTCAAGCGCGATGACGTTGACGCCAAGAAGCATGTTCACCCGTGAGTTTCTGCTTACTTACTGCCCCCTGTACTTACCCTTCA
AGTTAACATGTGTACTGTACCTGCCCCATTTTGCAGGAGTGCTGGTCTGCAGGACGGCAATACATCGACCAAGACACCGATCCACTTTGGGGATCAAATT
TGCCTTCTCTCATCCAGCTCCGACCTGCCCCTCGCTATTGGACCTGATGGCTGCAGCCATCCAGCACACGACAGTTCCGCGGGGCCGCACATGACATTCA
CCATTGTGCGTTGTCATTTGTATTTTCTTCACTGTGTTGATCATAGTCCAGTTACTGACTCCGCCTTCTGCTCAGGTGGACTTCCGAAATCCCTCGCGAA
ACGACGAAGTCACGGCCACAGACGATTTCTGGCTCCGTGTAGACCCTGCAGTTCTAGCACCTCGCAAGTTTGACCCTCGTCGTTTTCGCTTCAATTCTGG
AAGTGGTGATGATTCCGACCCGACGGATGGTGGCGGtagcggcgacgacgacttaTCCTCATTCCTCAGCGACACAAGCTACTATCTAGGGTGCCCTGGT
TGGCTAGATGATGGCGAGTCTAACGCAGCTTCTCTTCAAGAACCATCAACTTCGACACAAAATGGAAATACTTTAGGAAGAACTGACGAAGAGCCCCGGC
TGCGCGGTCAAAGGCGCTTTCGTTTAGTGGCAATGAAAGCTCTAACCCCTTCAAGAGATTACTATGGAGATGATGTGGCAACGCGCGAATATGCAGCGGA
AACCAACGAAGGTATCATGCGCTTGGCACGCTGGCGGTTTGTGAGGTACACCCCTCGGAGGCACGAGCAGGTAGCTGGGAAGACACAAAATACCAGTGGC
AGCGATTTTGACAAGGAGCAAGACGTCAACGACGCCATGGTGAATTGTTCAACAGTATACCTCGTCCTGAGCGATTTTGCGCTCGTGTATGACGCAGGTC
TCAAGCGTGGAGTG