Description :
From Genome Similarity Track
Location :
Scaffold_15:410547- 413549
Sequence
3002 bases(100 bases per row)
TATTTCTGCTAACAGCATGACACAGTCGTGCACAGATGCTCCTATTGAGGCGAACTTTAAGGCTGAGAACCTTGGCAGCAACTGGTTGAAAAACAGGTTT
CGGTGTGTGCATTGTGTATGCAGATCTCTTTTCTTCTACATAGTGACTAGCGAATTCCTTCCGGCACGGTTTTTCCATCGCATTTTGCTTTTCACTCGGT
CCGGCCACCCTACATAGTGAGAACCTGCTTTATGGAGCTATAATAATACCTGTAAAACTGTTAAAAGCAGTGTGAAACGATATTAACGGGTAAAAACATT
ACAAGCTGGTAAGAAGTGGTAGTAAGTGGAAATAACGTAAAAACTTGGTAAAAAGTGTTAATAACTGTTAGAAAGTCACGGAACTTTTTACCTAGCATCC
CTACCACTGACGATCCAGTCGATGGCCAGATGCGTCCACAACTGATCCTTTCTGTCACACACGCATAAAACAGTGTTCATCATCAGAAGATGGCCAGACG
ATGACCAGACCAGTTGAAGCAAAATTTGAGAATTGGATTGTAATACGGGTAACTCTAAATACACCTACCTTTATTGCTGAATACACCTACATGATTCGTA
GGTTATCCATTTAACTTAAATAAACTATGCTGACAAATACTGAAAGAAGATCCGCTTTTTAACAAGAGAACGTCCAATAGTTAGCCTCAGTCAGACCTCT
CTTTCCGTCTTCGTAACTTTATCGTCTACATGATGATGAGCCATCATATCTTCACCTCTGGCGGTGCAGCTCACAAAGTAAAATATTCAGTCGCTCCTAC
ATCGGCCTCCTTTGCTATTCTTGATACTGCTATTAATCAATCCTTTCACCCCGGCTCGAGAAGACCCCTACCGGTCGGTCCATTCGGAAGTCAAGAGGAA
GCTGTCCGTACCGTGAAGCGGTATGCTGTGCGCCAAGGTTTAGCTGTCAGCATTGTTCACACAAGATCGCGCGGCATAATGCGCGTTCTTCTTTGTTGCT
TGCAAGGAAGACTATCGTAATTCAACGGGTGGTTGGTGTCGTTGCTAGACCGCGGAAGTAAAGTCGTTTGCAGTTTGTGTGATCTCGCGATCATCTTTAT
CAAGAACTTGCGCACCATTGAGCCTGGTCGACACTTTTAAACAACTGTCACTTTAGACTCACCCGACGCATGAACAATACCGGCGGCGCGGCGTGTGTCA
CGAGAAGGAGACGGCCGCATTTGTCCAGATGCATCAATCTGTAGCTGCTGCACAATAACTTGCGCGTATGTGATAATGTGAAAATACATTTAACACGTGC
CATACCTATTTTTATTTCAGGGTTACTGAACCACCTATAGGAGACCAACATCATTACGAGAGCAAAGTGATGTCCACAACCACTTCCAATAAGCTATCTT
AACGGCTCTGCGCGTGAGAACGAATCCAGTGTCTCCACCAAGACCGCGATGCTTTCGCCTCCATCCTTTTTCGTACAGAATCGTCCGACCTACATAATGT
CGGCATGCTCTTGCGTTCGCTAACGGGCAACCCTCAAAACTGAAAAATGAAAGACAATGGAAGGTTGAGAATTCTCCTAAATGAAGGAGGTCACAGTGTA
ACGTTAAATCAACGGGGGGCTTATATAAAATAGATGTTCTCTTGCTAAATTGTGGCTGTTCTCTTGTTAAATAGTGGATGCTCTCTCAGCATTTGTCAAC
ATCGTTTATTTAAGCTAAATGGATAGCCTATGAATCATGTAGGTGTATTTAGCAATAAATGTAGGTGTAATTAGAGTTACCCTTGTAATACTCGAGACAT
GGTCGTGGTCTCATCTATATTTCAGTGTATATCGAAGGTCGTCGATTCAAAAAGCTAGCGGGAACATGTTGTGTATACAATGTACCACAGTTTCCGTCAA
AATTTTGAGCCGGACGTAACGATTAGAGCCTGATGTGGTGTCTGGCTATATAGTAGTAAAACGTGAACGTCGATTAAGTACTTATGACTATACGAAATCG
GTGTGCTGCTGCCTAAACTACATCATCTCCTTCTCGCTGGCTCAGTCTGCTGGCTCGACACTTCGGTCATCACGGGGGACATTCCGCAGGGGGCACGTAG
AATCGGATATTCAGCCCGGGGTGCAGACAGGGCGCTGAAGTCGCGGAAAACGCCAGGTACTACACCGATCACCCCCGATGGGCCGCTGACGCACCTGGAC
TGGGCCGATCATAATCACGTTCTAGGCATGTTCTCTTCATGGGCTCGGGATCGTGCTCGGCGACCGGGCCGGCTACTCGAAGGCAGACGCCGAATAGTAG
GAATTAGGTGGGGGTGAAACTATGCCCTTCACCCCGGCGTGTCTTGGTTGTTGCTCCCCTTTCGGTTTGCACGCTGCGCTGCCTCACGTAGCGAAAGCAG
CGGCAAGAATGCCTCCTCCTTTAATCTGGGCCCCACGATAGGGGACTTCCCACCTAGGGTAGGGGAGCCGGTCGCTCGGCTCTATAGAGGTCTTCATCGC
TTGACCGTTGTTGCCCAAAGGCGCAAATTGGGAAGTGCGTCTGGCTATATGGATTCGCGCCGAAGCGAACCAAGCAGTTGTTAGGCTACAAACATCTATT
TCGAATCACGCGGATACTTATTGGCATGTCTTGCCGTACTACTCGCATATTCAGCGTACTGGTGCCATATCGACTTTACATGAAACCAGTAAGTAAATTA
TATCGTCTGCGCAGCGATGTGGCCATGAGAATGCACCATAATGGGCTAACACGAAGCTGTGATAATTGTAACGAGGTGTGTCTGCTACTGATATTTTACA
TTAGGCCACGGATCGTGACACAATCCTTCTGAATCCTAACACAGTCTGTTGAGATGTGACCAATTTATGTAATTATATGATTTGTCCATTTTTGTAACAA
GAGGGATGGGGTTAAACTCTAAATACAGATAAACCTGGCTAATCTGATCCCTGAGAAATATGAAATACTGCTATATATGGGTAGGTGCTGATCCACCAGT
TT