Description :
From Genome Similarity Track
Location :
Scaffold_221:4103- 8478
Transcript NameFunction/comments
Phyke_g6833type I inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
4375 bases(100 bases per row)
TAAGAAAGCGATTGATTCCCGCCACCTGTGCCAGGGGGGCACTGGTAATCTGTTGGTAGCATGTAGTTTTGCAGTGCGCTAAAGCAATACTGAGCTTTTC
CGATGTTCTTCCGGGCATTCTCGCGTCGAACACCATACGTGCGAAGCAGATTTGTGAAtgcttccacttcatcaggAAGAAGTCCGTGTGAACGCGCAAG
CAGGTTTGCTTCTTCGAGAGTAACTGACATCGATGTACGATCTTTTGCAGATTTGCACATCGTCACACGACCTCCACCAACGACACGCGCGATGGAGGAA
GACAGACTCAAGATAGACATCCGCTTGGATCGCCCAGATTGTTGTATGCTTTCTTTGAGTGCCAAGAGAGATGCTTGAATCCGGCCGAGATCTTCTGCGG
TGTACATGGAAGTCGACGCTTCATCGCTACGGTGGTTCATCGAGCACCACTCCGTAAATTCGCTGACATATTCTTCCAGTTCCGCCACATTCTCAGTATT
AATTTCCTTCTGTAATGACGCCTTACCGACAGTATTTGCGACCGTCTGCATCTCATTCATCCCCTGGGAGAAGATCACAGGCACGACCCGAATGGGTTTC
TGAAACAACAGCTTTGCACGCATTTTCTGTCCTGCCGTCAATAACGGTAAATAAATAGCCCCCGAAAACGCGTCCTGCCCCGGAATCCGATGCATGTTAC
GATCTGGAAATTCGCGTGCACTACGTGTAATGATAGGAAGTTCTATCACAATGCCCGTGGGTCCAGCAGTGATAGAGACTCggaaagctgcagcgcgcGG
CGATTTTACAGGCCGTAACTTTATGTGGACCCTCCCCAGTTCCTTTACAGCCGCCTCTGTGTCCCCCAGCATTCCCAGTTCGTTACCATACGTAGACAGC
AGCGACTCTACTGAAAACAGAAACCCAACTTTCGATAGTATCTCCAAGTAGTCGATGCCCCGAGCCTTTAACGGGTGGGAGCCAAAGCTTAGGTGGTCGT
GCGTATGCACGTAAAGAGTTTGCTGAAAGCACGTGACAAGTGCACTCATCGACTGGGAAAATGCCACTTCAAGCCGACGTTCCACATCCCACTTTAACTC
GTTGTACTTACGTTCAAGAGCATCCATCGTGAGATCTGAGCTCCCCTGCGCTTCTTTCACCAGGCGCGCATGAAGCCGCTCGAGCTCTTCGCGCATTTGT
CGGACGCCGCCACTTTTAAACCCGTACACATGTGCTGCAAATGCCCCGACTGTTGTCGTACCGTACATCCGATGATTGTGAAATGAGGCGCGGCAATTAA
ATGCTGTATCAATCGCCATCGATGATTTATTCTCTTGGGCGTTGGGTATAATGACGTCTATCGCTTCATTTCCCACATTGCAGTCCATCCCACGCTTCGC
TTCTAATAAATCAATATTGCCTGGGGTCAGGCCCGCATCAAACTCAGCTGCAACAGTATCCGATACAGCAGTATCATCTATGCCATAGATACTctcaaac
tcttcttcagtGATCCCCATGGCTACGATGGTTTCTGCTAACTTCCTCTGCTCAGCAGGTACACCAACATTTTGCCCTTCAGCTCCTTTGTTTACAATCG
TTTCTGCTGAATCGAATGAGATTACTCGACGACGCAACGCCTCGACAGGTTCAAGTGGTTGTTCTTCCGACGTGGAATATTGCATCCGTACACTCTCGTC
GAAGACATCGCTTTCCATTGGCCTAGAGTCATCAAGATTACTCTGCCGCACACTGGACTCTCTGGACACGTGCAACGGAGACGATAGCATCGTTCCAACA
AACGAGTTCACAAGACGAGTGTAACGTGCTGCGGTAGATTGGTCGCCATAGTAAACATCTCTTTCCGAGGTTGGGACAGCATTGCCCACAGTCATCAATT
GCTGGTGAAGGTTCAAAGCTAAAAATCGTAGATCTGCATCTGCTTTCATGGTGCTTGGTTTGAAAGTGAGCCCGGCGTGCTGAGTGGCTCCGTATCGCAA
AATCGAGTCCTCCACTTCAGAAATATATTTTTCCATTGTTTTCACCAAATCCAATCGCCACTTCCGTTTTTTTCTCTCGACAGCATCGTCTTGAATTTGA
ATAATCATTTCGGATAGCATACCTATACTGGGTGCGGACCTGGTACGGTTTTCAGGCTGTAATGAGGAATTCACACCGGaagccagcagcaaggacTCCG
AGCCTTCAGTCGACTGCGTGGTGTCGCCTAATCCACCTTCTTGCACAGTGCCAAGACCTCTTGGTGACGCAGGAGCTAGAGAAGGCACTGAATAGCCACC
GACGCTAGGCGTCGATAGTTGACtagatggagttgatgaagaactcccgtcgccatcttcaactGCAATTGCACGTTTAAGTACATCAAGTTTCACCAGC
AAGTCGGACAGGATCAACTGAAGCAACTGATAGGGTACCTCCCACGTATACACACTTTCGAtcagctcttcttcaactAGCATTTTTCCTTGTGCGCGTT
GAGAGATGGATGCAAGATCAATCATTTGCTGAGCAATCTCGGAATATGCTGAGGTATCACTAGACACAGCCTTGTCGGTGTCCGTATTTTCGATCCCGAT
ATACATAAATGACCGAGTGATGCGCTCAAGTCCACCAGCATACATCTTAGCGTCCAACCCTTTCACCTCGGCTTCACAACGTATAACAATTTCGCCCGAG
GACCGCGTTCGCGACAATGGTGAAAATAACGGAAATATTGAGGCTCGGCCAACCGAAGGTATAGACTCACTCATAAATGACGACAGCGGAACAAGTGGGT
CACCCACAAGCCACTGGCTATTGAGATCCTCCAGGGAGCTCGGATTCCGAACAGAGTACACTGAGGCACGAAGCACATCACACTGGCGCATTTCAACGGC
CAGCATTAAGTGGAAACACGGGTCCTCCGAATGCGAAATCTCAGTCCGGCCGATCTCAGCCAACACTGCGCCTGTCTCCGGATCTATAAGGTGAAGCACA
AcgaacgacgacgacaacagaGATGCCTTTGTTGGCAACTTCAAATTGAAGCACTGAAACGACAGCCATGCGGACACAAGACAAGAACCTGCTGACCCAG
ACGAGTTGGAGTTCCATAAGTGACCAGACACAGCCACTTGCTTGGCCTGTCTTTCGAATCCAACCACCGACGGtgagctggcagcagcacttgcagaGTC
ATTTTTTATGGAACTGTTGGCCAATGTTTCTTCGCCTTTGCTCCCACCTCCCAAATGCTGCCGCACCACAAGCTCCAATCGACGTCTTGCGCGATCCAGT
ACACCACTTCCTAGTCCTAGTGACAGCGGGCTAGGTCGACGACGAGTAGTCCAATATCGTCCCTGTCCACCAGACGGCGAATTTGAGGCCATTGCTTCGT
TATTCGTCGCCAGAACACCGCTCGAGCCCTTACCCGATACTAACAATGGCCAAGGTACCGCTTCATTATCTAGAAGCGGGGTCGACTCGGATGTTGCCCC
TACATTATTGTAGCTGAGGCTTCGACGCGTAGGGAACTGTAATGTCGGTTCTACTTCCCACATCAAGATTAAAAACAGCGCACAAGGCACAAGCTCAGGA
ATTGCATACCCCACGACGACACAAACATCCGGGCTATGGATATCACCGCATCCCTGATGGGAGAATGGTCTCTGGATGTACATGATGGTGCGTAGTAGAA
ACAACACTGCACAGACACCCATGACCACGATGGTAAACCTCAATGCTCGCGTGAGTTTCTTTTCCACACGTTCATCCACACGTCTTCTCAGTCCATTGCC
CGATGGCCTCAGTACTCTCTCCACTCGACGTCTCATCTTCCACGTGGAATAGACCAGTCCCAGGGAGCTCACAAAGCTGCCCAGTGCGATGAACAGCACG
GGCAAAACTCCCGTCCAGAGCGTCGACTTGTCTAGCTTCGTGCGTGTGTGTTCTGCCTTGGTAACTTTGGCCAAATGCAGCACTGAGAGTCCCAATATAA
TTGCGTAGAAGAGGCCGTTGGAGAGGACAAACGTGATCCAGATGCGTCTCGAGCGTCGAGAGATCTTTGGATTGGCGATGTCGATCCAGAAGAGCGTCTG
GAAGAGCACGAGGGAAAAGAAAAAGCACAAAGAAGCTCGGTTTAACAGATTCCTCAGCACTCCTTGACTCAGGAAAGAGGCTGCACGCGTCACAGCGAAC
AGCACCATGAGACGCTGGAAAGTGTTTCGCTGACTGCTGTGGAAGGCTGAGGAGGACTGCAGAGTCGAGAGAGAGAGTACTCGACAGGCAGCTACGAGGC
CAAGAGTGAGGTAAACAGCCACACATAGAGTCTCGAGAGCTGCAGACGCCTGTGGGAGGAAAACCAAACCGTCGT