Description :
From Genome Similarity Track
Location :
Scaffold_102:41021- 45534
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_102-snap-gene-0.22Vacuolar protein sorting-associated protein

Sequence
4513 bases(100 bases per row)
CGATGAAACGGATAGAACAGCGCAGTACTTGCTGTTTTCCTGTCCGACTATTGAAGCTCCCTTTTCGATTAGAAGTCCACCGCGTCGTGGGGGCAACAAA
GCTTCGATGTACACGAACCCTCGCGTTCGGCCGCGAAGACAGCGAGAGCGAGTCATTTCACTTCGCCGAGGCGACCCTACTGCCTCTCCGAGTGGATCCA
GACGAGCGGGAGTTGCTCCAGAGTACCTTCTGGAGCTTTCGTACAGCTCGATGAATGACGAGAAGACTGGCCGTGAAGTGTTACGCGACCTCGATGTTCA
GGTCGGGTCTATTCAGGTGATTTTTGACCAAACCTATGTCTGTTCGCTATTTGAGTTGTTTGAAGAAGCGTCAGTCCAGGTATCTATCGTTCCAGCATCA
ACCAGACACTATTCAGTTGCGGATGGCACAATTGATGATAATCTTCCACCACTGGAGCTCTCGCCGACAATCGAGCAAGAGTACAAGCTTCCTGTGACTC
TGACTGATTCCGTTCGTGCGGATCTCGAGCGTGCTCGACTGGATCTACTTCAGAACGGAAATGGAAACCAAGTGAAGCAGCCGCCGCTTCCTGCTTTGGC
AGCGTTAAAGGTGAACGCTCACATCCATTCCGTGTCAATTTGTTTTTCAGACCGTGGCGAGCCAGTCGCGTCCGTGGCAATTCTGCGTTCGGAATGCCAG
TTGTCCACGACACCGCGAGATGAAATGAAGTTGGTTGGAGCGATTGGAGACATTAAGGTATTTGATCTGTCCTCGGGGACAAAAGACGGCGAACTGGGCA
TTTCTTCCTATGCGAGAAATCGCGAGACTGCGGCCACGTCAGAATATCGGGAGATTTTCGGTCAGAGTCTACGACTTATCGAAGATGCTGTGTCAGACGT
CCCAACTGGTCTGATTACATTCGATTGTCTCTTTCTTCAGAATGGAGCGGCAGAAGACCGTTTCGTGGCCGAGAGTGACGGCGCTGTGGATCGCAAGTCG
CCAGGCAAATCGAAAATTGCGGTATCGGTCCACCCAGCTCGCCTCGTTGTGCAGCCTGACTTTATTGAAAGTGTTGCCGTGTATCTGCTGGACGGATCCA
TGAGATCGCTGTTCCTTGCCAGACAGTCGGAGCTTGTCGTTGATTTGGCAGACGACAAATCCGAATCGGAAGCATCGATGAACGACGTGCAATTTGCGTC
ACCACCGACAGAGAGAGAGTTTGCTCCAGAGAGTTCGACTCCGTTTTTCGAAGCTGTTGAAGCATTGAGCAAGAGCAACGATGAAGCACGGCCACTGGAG
CGACACTCTAGGCCAAAAGTTGTTCCCAGGAATGACAGTGTCGGACGCGACAGTGTTGGTCCAGCCGTACAACCCACCGTTCCAGAGCAGTTTGATTACG
AAGGTATTTTGACCCAGTTTGATTTTGAGATCAAGCTGATCCACCCGTCCATCGCTTTCCCGTCGTTCTCATTGGAATCGAGCAGTGTGATGGGAGGACG
GCAAAGCGGTATTGTGGTGGATTTCGGGGTGATCAGTGGGACAACTAACGACAGTGAACTGTCCAGCGGAAACGAATCGACCTTTGGGATCAACGTTCAT
GTCGCGGATATCGGGGTGTCTTCATTATCATTCGGCATGCCAATTCTGGAGCCGTTCGGGTTTGGAGTGCAGCTGTTGTTGCCGAGTACAGCTAAGAAGC
TCGAGGTGGACACTTCTGGGGACTCTCATCACGCCGACTTGGCAGTAACGATATCGCCGATATGCGTCAATGTCAGTGACGCCAATGTTTGCCTGCTGCT
TGACGTGCTGTTTGGCGCGGTCCTTCCCATTCAGACTGTCGTTTCAGAAGTTATCCAGCACTTGGGCAGCAAAGACGCTGGCAATGCCAGTGTGCGAGAG
AACACGGCTACGAATCGGAAGCCATCTGCTGGACATGATGTTCTGCCGTGGCGATGGACTGTCCGTTGCAAGTTGGAAGAGTTCAAGATTCTGCTTCTGT
CGAGCGTCGACTCAAGCCAGAACCTAGAAGCGTTGGTCAAGCAAGTGTTCGATGCTCCTGGTATTGGATTGACACGGGGTAGTTTGGCCAGTTCTAGTTT
GGCTGACATTCAGCTGGGCTCTCCACGTCGCTTCCAGAGGTCGGACAGTGACGATTCTTGGGATCACCAGGACGCAGATCCAGCTCAAGTGGATCGCATC
CCGGTTGGAGATATGACGCTGGCGTCTTTGAGTATTCATTTGGTTGTTGAGCCTGGTCCAATAGGACAAAACTCGTTTCAATGCGACTTCTCGATGCAGG
AAGCGTCGATCTCTGACCGAATCTCGGACCCAGCGGTACGCCCTTGCCGTTTGTTTGTTTTGTATGTGGAATATGACTGACATGTCTGTTTTTGCTGCAG
GAGTATTTGACGCAGCTTGTCGGACTTGTTCCGGATGCACCGATGCTGAATGATGTCGAACATACGACTCTGTTCGCTGTGCCAAGAAGTGACGACGCAA
CTACCACGACAGTCCAGCCTCAGCTGATAGGAACGTGTTCAATCCACCATCGCAGCGCTTTGAATCGCGAAAAGGACACTCGAGATGACGAGAATCACCT
CGATATTTTGGTTTCTTCGGCGCGCTTCATGCTACTCCCACGCACCGTTTTGCGCCTGGAGCAATTCGGTCTTGACGTCTACGCAGCTTCTAGCCGTAAG
TGGATGCAACTGCGGCGCGATTACGACTCGTTGATGGAAAGCAAGCCATCTCGTTTGGGGAAGCCTGGATTTCTGGAGTCGGCAATTGAAATGGATGATC
TTCGTGCCTTGGACTCCGACCTTCGATATGGAGTCCCAGTTTTGAGGTCGCGACGAGACAGCGTCTCCGAATCGCTGAAAGATGACATGAGCGTCGTTCG
GTCGGCCTTTATGTCTCCGATTCAACGCATGCTTAGTACTGCGAGCGCGAGAGATGCCCGAGTTCCAAACATCCAGCCTAATGCAATATCGGAAGGCGAC
AAGGAGTCCGATCATGAAATGGATTCTTCCGAGAGTCCTGAACCGGGAAGCAAAATTGCGCGGTCGAATACCCCGAGCTGGAAAGTCGAACTGGAGCTTG
CTCATCTGGAGCTTTGGGTCGTCTCAACGGATCAAAAGGCTGATGCTGCAGGCTGCGTGCTCTTCAGCACGCTGAACTTCGGTGCCGACACCTCACCAGT
TGTGCATGACGACGCTACCACTGCGCTGGCATCCGAAAGGTTGGTATCGGCGTTCTTGAGTCTGGCCAATGTGAAAGTGCAGATGGACTCCCCTCTTGGT
GCCTTTGAGCGCTCGTCGGCTACCATCCTGAAGAGCGCCAACTTTCCGTGGATACTTGTGGAGCAGTTCGACGTCGACTCAACCGTTATCGTGGAACACA
ACTGCAGACTGGCGTCCAATGACACAATCATCGAGTTGAGTGACGAGCAGGCAAGGCAGTCGAAGAGGGACGACGAGCACACGTTTCCCAAGCATATGAA
CTCGAGGCAACTTGGCAGAGATGTTCCTTCTGAATGGGCGAAATGGTTTGCTTGTGTTCCTAGTATCACTGTAGACGAGATTGTATCACGGGTCTCGTAT
CGTGATTTACCGCTGCTACTCAAGATCGCATCGAGTCTGAGCAACATGGTCAAGACAGAAGCCAGATTGCGAGAAATGGTAGAATCCAGCAACTCGGCGG
ACCATGACGATATTTGGGATGACTTCCCCGATACTCCGAAAGATGCGTCCAAGTTTGGGTTCTTTGACACTGAAGGAAGCGAGAACGGCCTGGAACTGGT
GGGAAAATCGAGCACACAGACTGTGGTCGATGGATCCATTCACCTCGGTGGATTGCAGTTTCGGTTTATCAACAATATTGTGGATCAGGAGTCTCCGGTG
GTCGGTATTCGCACACAAGCAATCGACGTCGCTGTGCGTGCAGATTCCAACGCTATGGTAAAGGTGTCTTCGAGTTGCACGGTGGAAGCCTGGTACCACA
ACTTGCGTCTGGTCGCGTCCGAGCCTCTCATCGAACCGTGGACGGCAGAATTTGAGCTTTCGCGGCAATCGCGTACGACCGAAGAAGCGTTCGAGAACGA
TGGTGATGAGGAGCCCTTACTCAAGGTGGCACCTTGGGAACTCAAACTGTCATCGAGAGAGTTTCTTCAAGTGAACTTGACAGATGCGTTTGTTGCTAAC
TTGACAGCAGCAAACCGCGCCTGGAGCTGGGTTGTGAACGAAGGTGGCGATCCAAGAGAGATTAGGGAGTACTCGACGTATTGGATTCGAAACAACACGG
GACTCCCGATGCAGTACTGGGACTCAGCGCATCGACCCAGATCTTTGCAGCCCGGCCGCGAAGAGCCGCTAAGATTTGGAGACCCGAGAGGGAGTAACCA
AGAAGGCCAAAACCCTCGTGGACGAGATCGACATCTCTTCATCGCTGTCGAAGAGGAGTATCCGAGCGACCCTTTGACGAACACAAGGAAGAAATGGCAG
AGCGAGACACCAA