Description :
From Genome Similarity Track
Location :
contig_32:410209- 411658
Transcript NameFunction/comments
g6237.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
TGCGCTGACCTTCACCTGCTGCTGACCTGAGCGCTTGCCACCACATGACATCCTGTCCACCTGCAGGGTACGCGCCATGGCTGTTCTGGGCTAAAACAAC
CCCGATACAACCAAAACACACACAAAGCAAGTAAGGCAAAAGAACAGTGTATTTAAAATATACTGCCTCTGCCCTGGATGCCAAAAGTGGAAATGAGCAC
CTGCATGCAGGCGCCGGCGCGAGGTCTACAGAATGCTTTTCAAACACCGTACTGGATTTAGTGTGCGACACGAAAAGGCAACTTGTGTGCTGTGACCGAT
ATGGTCACAATCAATCTGATGACGTCCGAAACGGACTCTACAAACTAATGACTATGAAAACTAATAAACTTTGGCTACCAGGCCTCATTTGCAAACTTGC
CGTGTAAGGCGCACTTGGCCCGAAGGGCCAAATGGCAGTTCATGTCCCTCAACGAGGAGAGCCCAAATCCGGCCTCCGATGAGCTCTAGGCGTTCTACAA
GCGCCAGAAAACGCAAAAAGTTGTTTTCGGCCACGCCGTTTTGTGAAATTGCACGATCTGACTGAACGAGTTTGCCAGGGATGTGCAACCCAATTTTGAC
CAATAATCTTCATCCCTGATGGCGAGCCAGGGAGGCTGTTGAGGTTAGGCTCGGCCACCTCGTGACTCAAATAAGACATATATTATGCATTACCGGAGTG
GCTATCTGAAAGGCAACTTCCACTCTGAAACGGTTGGCAATGGCCAACCTGTACTATGTTTTTGGCAGCAGTATAGAGTTTTCTAGCTTCGTTGTTCTTC
TAACTGCTCATTAATGCTCACTATTTCTTTTACCATTCTCCGTACAAGTTCTGTCCTTCAAGCGCTAAAGCTGCCCCCGCAACATTCTTGAGCTTGGAGA
AGAGCAGATGACGCTTCAGGAACTCGCCAGCCCGGGTGATTGCAAACGTGGCAGTAAACCGCTTGTGGCTGCTACCTCCTTCCGCAATAACACCTCCCTG
GCGCCCCGGGGTGCAATAGTTGCGTTGGGCTCGGTCTCAAAGTATCTCGGTACTTGGTCCATGTTTATTATGTTGCACGATTCGATCCGGTGCTCATCGA
TCAGACTTTGTCCGTCGTGGATGAACTTTAGGCACACCTCCTTGGCATCTGCAGAAAGCGTCCGCGTGGTTGTGTGGCGGCGCGATACAAGATTGTAGCG
GTTCTTGAATTTCGACAAACCAGCCGGAAGAAGCCCTGAAAGTCGGAGGCGAGGAGCCCGATGAGTCATTTTCAGCCAGGCTCCGGCTGATATTGAGGGC
TTGGAGCTGAATATATTTATCTTTGACACGAAGACCCTTCTTGTTCCTGCTTTTCACCCAAGCATCCAGTCGTTCTTCCAACCGCTGGTGCTGCGGCTAC
TGTCCAGCTCCGGGAAATCGACGCATCACACGAGCGCAAGCCTGTCAAT