Description :
From Genome Similarity Track
Location :
Scaffold_125:41019- 42315
Sequence
1296 bases(100 bases per row)
TTCATAACCACCCACCGTCCGAAAATGCTCGAGCCCACGCGTGCCATCGACGGCGTGCGGCGGCTGCGGAAACCTATGTCGGTACCAATCAATCCGTGCA
GGCGTTGGTTGAGGCCCAGACTGCTGCTGGAGTGTCCGTAACAAGTATTCGCGCCACGCTTCTCCAAGCCGATCCAACTTCCTTCGTCATCCCTAAGGAC
ATCGCTAACACGAAGAACGCCGTCCGACGCAGAGAATTGTCCACCAACACCGCAATGAAGGCTCTCGTCGCTGACCTCTCGCGCCGCGGACTCCTTTATC
GCTACGAAACCAACGCAGAGACGCAGGAATTGCGTTACCTGTTCTGGGCGCACCCAGGCACTGCAGTCTTGTATCGCAGGCACCACGATATCCTCGTCGT
GGATTGCACTTACAAGACGAACAAGTTTAAGATCCCGCTGTTCAACATCATTGCTGTGACGGGTTTCAACACCGTCCTCCCGGTCGCGCAGTGTTGGCTC
TCTGGAGAAAAGGAGGAGGATTGCGTGTGGGCTCTGAACATGCTCCGCCTTTTCTTGATCGAGAAGGACGTTGAGTTGTCTGGTGTTGTTCTATCCGACC
GCGAACAAGCGTGCATGAATGCAGTTGCCCGGGTTCTGCCTGAAGGTCCGTCAATGGTGTGTCGTTGGCACATGAACACGAACGTGGAGGCAACGGCCCG
CAAACATCTTGGCCAAGTGACCGTGGTGGACCCTACAACTGGCGTGAGGTCAAAGGAGAATACATGGGAAACGAATGCCGTCATGGCGGCATTCCACGAG
GCAGTGGATTCAAAGACGGAGTCAGAATTCGAGACGCGTGCTGTCGCTCTGAAGACACACAGCAGTTATCTGGACACCAACCGGTGGAAGTACAAGACGA
GAATTGTCCGTGCCTGGACCGACCGGTACCCCCACTTCGGATTTCGTGACACCTCGCTGGTTGAAGGAACTCATGCCAAGTGCAAGGAGTGGATTTGCAG
CAGCCAAGGAGACCTGTTCACCGTGTTTAAAGTCTTCTACCGTGGGGGGACGGAGCTGGGGCTGACACGCGAATGATATCAGCCCAGAATGGTTACGGCA
CGCCTGCGCTTTTGCAACAAAGCCAATACTCGGCTGTTGTCCGGGTGATCACCGTGTTTGCGCTGACAGAGACTCAGAAGTTGTGGAAGGATGCGAGCAA
GATCGTCTACAATCGTCTTCCGAGGGATACGTGCTCCGGGACGTTTCGAGTTGTGCATGGTCGGTCATGCTTACACGACCTCGCAACGATCATAGA