Description :
From Genome Similarity Track
Location :
contig_38:410119- 415885
Transcript NameFunction/comments
g8403.t1hypothetical protein
g8404.t1XP_008911572.1 hypothetical protein PPTG_16044 [Phytophthora parasitica INRA-310

Sequence
5766 bases(100 bases per row)
TCGTCATCGATGAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGCGGCAGCAGCGCGAAGAGGCCGTGGCCGCTTTTGCGCACGAAGCCGCCGCGCA
CCAGCAGCTGGTGGCTGAGAACCGCGGCGTCTGACGGCGCCTCCTTCTCCGTGGGCGCCCACAACACAGAACGCAAGGCGCAGGGGGCGGCGCGTACCGC
CTGGGACGACGACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCGAGCAGCCCACATGAGCAGCGATTTGAGCCGCAAAAAAGGCAAGTATCTCTGG
TGTGTGGCGTACACCACATTATTTTACGACATGGCTTCGTTTTTCTCTGCAATGGACTCCCTTCAACAAGTAAAAAATTGGCATGGGATACTGTCGGAAG
CCCCGCAAGATGATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTCGGTCGAGTTCGTCTTGTTCGCTGCAAATGCTGGGCTGACTCATCAGCTGGGG
AGAATAGTTGTTGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTGGCCAACCCCGCAGTCGCCTATTCGTGTTCCGTCCCTTGTCGTCACCACGTCC
GTTTGCACGCAGTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGCACGGTTTCAGGGCGTTATTGCCAACAAGTCCATTGCCGAGGACAGGTTGCAC
TCAGGATAGGTACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCAACGCATCCAAAGTCCAACGCAAGAGAAAAAGTGTAGGCTGGATATTGTGGTC
CGTAATACCATGTGCATCTCCGCATACACCGCCACATCCGACCCCGTCTCCGTCCCATAATACCCTATGCCAATTAAACCGGCTGGCGACCTTGACGTTG
TCCGAAAAATACAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCCTCGATCGATGGCTTCAGCTTGGCGCCAGCATCCGCACGATCCGTGGGACCTG
CCGTCGCCGCCGCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAGCGCTCACACTTTTCACGCCGCAGCACGCGCGCCCAGAGCCAAGCGAGAGCCC
AAGCGCAGCAGGCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCGACCGACGAGCGCCGCAGCCTCCTGGCCGCCATGTTCGGTGGTCGCAGCAAGT
CACGCACGTCGCGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAGCGAGAAAAGGCCTTCCGCCTCGTGCGCCACGGCTCGGACCCGCTGCTGAACGA
CGCGTTCTACGCCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGGGCTGGCTCACCAAGCAGGGCCACATGTGGAAGAGCTGGAAGACGCGCTTTTTT
GTGCTCTTCTCGGACGGAACGTTCGCCTACTACAAGAACAAGGGCCGCAAGAAAATCAAGGGCTGCATGCAGCTCAATGACGGCGTCGTGTCCGTGCAAC
ACGTGGACGTCCGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAGAAGGGGTTTTACAAGCTGCTGTGTTATTGCTGCAGCCAGTTTGAGGCCGAGCT
GTGGGTCGCAGCGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTTACGAGACGGATCTAACGGCCACTGAGGAGAAGGCGGGCTCCAACGCGGTCACG
AGACACTTGAACAAGATTTTCATCACAGATAAGCAGATCGCCAAGAGTTTGGTGCAGTTCAAGGTGAACGAGCACGACCATTCGTACGCAGCAATTCACA
ATTTTATTGTCGAGCTGGACGACGCGATCATTGATGGTCATCACTTGGAGCTCTATCAGGACCCAGAGATTGAGCTGCTGCCTGGTAATGACCTGGTACG
GCTGATTCGTCGACATGTGGAAGATCGAGTGTTTATTCCGTTGTATGCGGAGGCGTACGCGAGCTTGGAGACGGACAAGGTCAAGACGAGGCGCAGCAAC
CTCGAGCAGAACCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTTTGGCATCTCGAAGGATTTATCCGTTTGCGACTGGAAGCTAGCCATCAATGTGA
TTAACATGCTCGAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTCATTTTATCAGCTGGAAAGGCCATCACGGAGTCTATTGCTCAATATAACGGCGA
CCTGTTCGAGGTATCAGATGAGACGCTGACGGCGGTTTTTCGGTACGTAGTTACAATGCGTCACTGAGCGATTTACCGATTCTGTGAGCGCTTCTCAAGT
ACGGATACCAGCACCACCCAGCGTGTCAGAACAAAGCAAACGTCGTTTCAGCTTTCCTCGATGGGATCAAATGGGTGGAGTGCTTCGAGACTGGCGATGA
AAGCTATCAGTTTGATTCTTTAGCGCTAGCAGGGTCTCGCGTGTCGGTATCTATCTCGACTAACGATGTCGGCATTCAGTTTACGACCGATGGCAATGGT
AGAGGGGCTATTGTTTACAGTGTGCGAAAGCAATCACAAGCAGCACTTAGCGCTTCAATCGTCCCTGGATTGTCGCTGATTGCCATCAACCACGAACCAG
TTATCGGGATGCCTTTCGACAAGATTATCCAGCGCGTGCGAACTGCGGCACTCCCTAAGCAACTCATTTTCATGACCGAGTTTTACTACTACCAGCTTCT
TTCGCTGGATTCGGAGATGTTTCGATACCTAATGTGTATTGCAGCGCGCCGTGGGGACTTGGATTCGGCTGCTTGGCTGCGGTCGTCCACGGTGGAGCTC
AATAAACTTTGCTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTGGATTCATCCCTGTATCTGGGAAGGGATCCCCACTTCACGCGGCAGTGCATAACG
GTCAACTCTCTATGGTGAAGTATCTTATCTCAAGAGGGGCTGATACGAACTTGTGCAATCAGAAAGGAAGACGCCCACTTCATGTCGTGAAGCAGTCGAT
TGATATGGCGTTGATCATTGAGAGCCTTATTGATGCGGGAGCTGACATTGACGTAGCGGAAAAACACGGTCTTACCCCGCTAATGTTCATGTGCTTTAGA
GCATCGCTTGAAGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATGTTCGCCGTGTTGCATGGTCGAATGGATTTTCGGCTCTGGAGTTTGCAGTGAAGA
GTGAACGAACAGAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAATCCAAATATGCCTACGCTGGACGGAAACACAAGTTTGCATATGGCAGCCGCTCT
CCCCCACGCTGATATAATCCTCCGGCTCCTACAGAGCGGTGCAAACCCCAATGTTCAGAATCGGTATGGTCAGACTCCGGCCACAGTCCTACTTGCGTCT
GCTCCTGGTGGAGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTTTAACATGTGCCGGTTGCCGGTTGGACAAACGTGATCTCTTTGGTCGCCAGGCTT
CTCACCTGGCAAACATCTCGCGAGATTCTCATGTCATGGGTCTACTTCGAAAGTTGGGATCGTTGAACCGAGCAGGCAATAGCGTTGATGTCGATATCTT
CGGTTGCTCACCTGTTGATTATAGTCATGGGATCGAGGTAAGCAAGGCGACAGAATATTTTGGATCGCAAATGCCGAACAATTCGTGGGAAATCATGACA
AGACCGACCACGTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGGATTTGATTCGCAAGTTAGTTGCAGGCACGGAAGTGGACTTGGTGGATGTGGTGGC
GTTCGTGCTCTTCTTGGACAGCTTCTCGAGTCTTAACGAATTGGTGGATCGGTTGAGCGAGCATGTCCGAAACGGGATTAAAAGTAAGTTTTGTGCGTGC
TTGTTTGTTAATCCTTCGCGCGGTCAATATGCACCTACATTAGACACTAACGTGGCATTTACCCATTTGTATTGTTCGTATAGGCCACGGACTTATCCGT
CTCTTCATCATGATCCTGCTTTTTAGAAATACGGAAACGAAGGAAGTAGATGATCTGTCTGATCGCTTCTACAGCCTGATCAGTCACAACATTGACGTCC
CTAGGGAAAAGTTGGTACCTCTTGTTGATGAGTATACCTCCCTTTATAGGGAATATTTCTCATTGCGAGGAGCTGGAAACTACGCCACAACTTACGAAAG
GATTCCAGAAATGATGACTAAGATATACGGCTTGGAGTCAGGCATTGAGTTCGTATCCAACGAGCCCTTTCCGCTTCATTTGCACCGGTAAGTCGAGTGA
TAGCTCATTGTCTCCCTTTTGATCGAACATATCTGACCTATGGATTTCGGTCCTCTTTCGTTGGGTAATATCTCAGGTATATTGATGCAGAACGGTGGGC
TGAACAGTGCACGCTTCTGACGCACGCAGTCTTTTGCCAGATTCCAGGTGGGATGTTATCGTCTGCTTGTTTAATTGGAGGGTTGACTAAACTTTGCTGT
CTCTAAAATGCAGTCCAAGATTTGATTTTGACAGGCTCGAAAAAGCAGCACTCCGTTGAATTTACGAGTATCAAACGATGGTTTCAGCACGTACGTTCTG
TTGTCGCTTTATATTTACGTGCTAAAGAGATTAACTTTCGGGCGTTTTTGTGCGTGGCAATATTGTGTAGATCTCTGCGTACGTGATCAACGCTGTTCTT
GTACAAAACTCCCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTATCTCAAGGTAAAAGGATATTTCGGCTCGTTTGACCTCTGGTGGGCTGCATGCTAAC
CTTTGATTTCGAACTATGATCAGGCCGCCGATTATTGCGTGTCATTACACAATCATGATACGCTGGCTTCGATCTTATACGCATTGCAATCTACTGCGGT
ACAACGGCTTAGAAAGTCGATCGATTGTGTACGTTATTACCAGCTATGTTCCTCTCGTGGGCACGAAGTCACGAATTCTGATTTGGTGGTGCATTACAGC
TAAGTGCGGAAGCGAAGAAGATGATGAACGAAATGCAGCTACTTTCCGACAAAGGATGTCGCGAGATGAACCGGTTGATGCGCAAAACTGTCAACCCCAG
TATGCCTTATATTGGGTTGTATCTCCAGGTAAAGACGCGCATTTCAAAGTGATGCCTTCGGACGAAAATGTCTGACATTGTGCGTGTTGATTTAGGGCTT
CGTCGGACTGAACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGTCAATGCGAGTCGGCTACGAAAAATGGGCGAGTTGGCAATGGAAATCTTGCACCGC
CAATCTGTTGCGTACACTCTTCAAAACGACGAGAGTATTGATGTGAGTAGCAATTTTGCCTGTCGTCGTAATCCTCAGCTGTGGATATCACGTCTAACCT
GCGAATGTAACTCTTTTGCAGAAACTGTTGCACGTTTCAATGCCGTATTCGTCGGAGGAGAGTCGATATGCTCGGTCATTGGAGGTCGAGCCGCGTGAAG
CAGATGCGATTCCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTGATGACGACCTCGACCTTGAAAATGAAGTTCGCGAGTCAGTTGGCGGCGATGGAAC
CTTTGGATTCCGCCAGTGGATTAGGAAGCAGCAAGTCGTGCACCGCAATCGCTCACGCTCTTCGCTGATAGCTTTGTACGAGTGGGTGTAGCTGTGATGT
GCTGTCTTCTGCGCCGTGCTTTGGTGAATACTTTTATCTATTCGTTGTGGAATGTTTTCGCCCAAC