Description :
From Genome Similarity Track
Location :
Scaffold_609:4100- 5908
Transcript NameFunction/comments
Albla_Nc14138750conserved hypothetical protein

Sequence
1808 bases(100 bases per row)
ATGTTCGCTTTCCATCAGCTTTGTCAGTAGCGGCATGAGACGATTCTTCAGCTCGGTCAGTGAGATGTATCCGCAGAAATTGAATCGTAACGACCGAATG
TGCTCATCCAGCTGCTCAGTTGTCATAGAATCCAGGAAGGATATGTCTTGCTGCGTCACAAGTTGGTCCGATCGTAACGCAGAAGGCATTCCTCGAACTA
CCAAGCCGCTCAGGGACGAGGTCCCAGTGCGCGCGCGAGCAAGTCTGGTGCTCAAATCGAAAACTTCGACATCAGAAGACGTACCGCGGTTGCCGATCGT
ATCAGGAGCATTCGCTTGGGCCCTTGCTAGTGTACGGGCTTTGGCGATTTTTGCCTGTTCCTTCCTTCGTTTTTTCTTTTCCTTTTCTGTTTGTAATCGA
AGCGGTTTGCGTTTAAGGATCAATTCGCTAGAGCTCTCCAGAGTTTCCGACAGATTCACCGCCTTTTCTTCCTTTACATCGATTCCCGTCTGACCAGCTG
GCGCCACTGTGAGATCCGAGCTTGCAACCGCGCCTGTGGTAGCATCATCTTCATCGAGATCATTTAAGCGTTCGTTACCGCTGAGTGAGATTGTATTCAT
GATCCTAATCAAGCCGCGTATTGTTTCTGGGCTTTGTGCGATCGCCAATTGTAATTGCGCCGCGCTCCGTTTACACAGATCAACGATTTTGATCGCTCGT
CTAACGGGTCCACAAACCTCACAGACGACTTTATTACACTGTTTAAAGTGTGAGAGAACATATCGGGAAGAGATGCAATGATCTGTTCGGCACTGGCGCT
GGTGGCACTGGCAGATGTGCTTCCAAAGGACCTTCATGCTCGCACAATACGGAAGGATACAAGCCGCTTCCGTACAAGTGCTCACATGACGCAACATGCA
CAGCCGCTCTTGTTGTCGACGAAGTACCAGTCGTTGCTCTTGTTCATTCATCGGTGGTCGGATGGCGCTGCAGACTTCACATTGCATGTTTCTGCATTTG
CGAAAATGAGAAAGCAATTGTCGTGTTGATTTGCAGCCGATTGTGCTGCACGCGGCTTCTGTGCATCGCGACACATGAGCTAGAAGCACTTTCACGCGAC
CGCAATAGTCGACGGAGCACTCTACATTCGTACACGTACGGGCATGTTTGAGCTGCACCAGTCTTCTTTTGAGCTCTTCTCTTTTCTGAGCAATGGCTGC
TTGATTCAGTGAAAGAGTTGGTGGGGCGGAAGCGGTTGCAGTAAGAGTATTTGCGTTGGGATTCTCTTCTTTTGTGAGTATTGGACTTGGGGTAGCCGAG
ATCGTTGGCCCATTCTCTGAAGGTGTAAGCGGTTTGGGATTTCTCGGCTGTTGAGGCATCACTGAACCAGCTACGTGTTGCTGGCGCTGCATTTGCTGTA
GTTGTTGCATCCGTCGAAGCTGCTGGAACTGCTGAAGCTGTTGTATCTGCTGCATTTGTGCATCTGTGAGGTTCATTCCGTGATACATATTCGACCCACT
TGTGGATACATTCGTCGATATGGGTGCAGTGGTATTCCCAGTGCTGTTGGTTGGACCACTTATCTCTTGAGGTGCGCTTAATGGTACTGAAGTGTACGTC
ATCGGATTCATAGATTGAGCAGCTGCAAATTCTGGCACCATTGTAAGAGATGGCGAATTAGCGTTCGACCTGGTCATGTGATTGCCATTCAAACCGTTGA
TTGCCTGCCTCTCGGATTCCGGCATTGCAATCGGTTCATCACTTGTCCCGTTCGCCATCTCATCAGCTTCTCTGTCTAATTCATCTAATATCGAGTTTCC
GTACCCGG