Description :
From Genome Similarity Track
Location :
Scaffold_164:410- 4388
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_164-fgenesh-gene-0.4Protoporphyrinogen oxidase

Sequence
3978 bases(100 bases per row)
ACTAGTACAGGCAGATAAAACTCCGTCGCGAGCGTCTGCGTGCCCTCGACACAGCTTATGTCGCAACTGTGGTGCAGCNNNNNNNNNNCGTGAGCAGGTC
TCATTTCTCGGGCATCGTGATCACGATGCCGGCCGAGTTGAGGGCAGAGTCAACGTTCACGACCGTGGCGCTCGTCACCTCGACCACTTTCTTGCGCACC
TACTGGTTGTGCTCGAAACGAGTCTTCCACGCCGCCACCTTCCCACGCGCCAGGGAGTTGCGCGGCGCAATGTACACGATCGCGGATGACGTACGTCGCG
GTCTTCTGTACCTCCGAGACTAGCACAGGCATATAAAACTCCATCGCGAGCGTCTGCGTGCCCTCCACACAGCTTATGTCGCNNNNNNNNNNGTGAGCTT
CCGCAGCGCCGTGACGCGCTCCTGCTGGATGCGCTCCAGGTTGTTCTCCTTCTCGTGCACAAGCTTCTGCCTCAATGCCTCGACGCGCTGCTCTGCGAGG
AACTCGTTCTCACGATCGCGCTCCTGCAGCGCCTGCCTGAGCAGTGCGATGCGCTGCTCGTGCAAATGGTCTATCTCGGCCTCTCGGTACGCCCACTCGC
GGTTTTCCTGCACCTCCATCATGGTCTTGCGTAACAGGAACGATGCCTCGTCCGTCATGGGCGGCAGCGAGGCCTCGAACAGCTTCTTTTTGCGGTTGCG
CTCGATCAGCTCGATCTCTGCCTGGCCTGCCGGTAGCCCTTTGTTATGGCGCAGATGCAGCAGACTCAGAATCTCGGGCGTCTCGTTGCTCGCACTCGAC
TTCTTGATCGTGTAGTCGGGCGTGTACGGGTCCGTCTGCGCGTCCGAGTCGCGGTACATGGTCTGGATGCCGACCGAGCGCGTCGGAGCCGACGTCTCAT
CGTCGTGCAGCTGGCGCTTCTTCGCAGTCGGAGGGGCTGCGACGGGCGAGAGCACCACCTCAGGCGGTTCTGCCTGGAGATGCGGGAGCACAGGCCGCTT
GAAGAACTTAGTGCGCTCAGCACCACTCACCATCGCGTAGCCCTCCATCGGATTGTTATTGCTGTTGTTGCTGACAACTGAGATCTGGGCTAGCTTGGCA
CCGCCTCCAGCGCGGTACATGCCCTTGGAGAACCTCCCTCCAGAGCTTGAGACAGTGTACACGGGGTCTGAGCACATGCAACAAGCAATAGAGAGAGCGG
TGAGCCTACAAGACTCAAACAGAGACGAGTGGTCACAGCTTCGTACCATAGACCGAGTCGAGTGCACGCGTTGGTACGAGGCGCGACATCTTGAGCAACA
GGCCTTTGGTGAACTCAGCAGCGTGGTGGCGGTCAACCTGTCTCTCATAAACGCCTGTCAGGACACACTCACTCCCAGGACGGAAGAGACACCCGTTTCT
TTTCCGCTCACTCTTCGTCTTCTGCCCTGTATAAATAGCCACAGCAGAAACACAAACCTCCGCACCGCAACATCATCGACAACACACCGTTCAGTCTTGA
CAGCAGGAGCCTTCAACATTGTTCCACATCCATCCTGTCATCATCAGCATACAGACTCATGTTCAGCTTCACAGTGTCTTGGTGTACTCTAGTGCCAGCG
CCTTGGAGCGCGTGACGCAGTCTGCGAGTCCCACACCGTAGAAGCTGTTGCCGCCGAGACTCAGGCCCGGCGCGAGCTGCTTCTCAATTTTCTCAAGCGT
CTTCCAGAAGCCCACGTGGTACTGCGGGATGCAGTTTTCCGCGAGCATCGCGCGCACAAAGTCCGGCTCCTTCGTGATTCCCAGGTGGCGCTTCACGGCG
TCGCGCGCGAGGTTCTCGACCTGGTTCAGCCTCATATTTGCGATCTGCGGGAAGTGGGCACCGCCGCACATCACGCTCAAGCGCGTCTGGGGCGTGAACG
ACGACGCCGAGTTCTGCGACGGGAACGCGTTCGAGTCAAACACCACGCCCAGCACCTTCTCACCCTCACAGGACGGCACGAGATACCCAAAGCCGTCGCT
CGCAAGCACCTTGTCGTTGAAGCCCACGTGGATCATGCCCATGGATACGAACTTGATCTCCTGGAGCGCCTGTGCAAGGGACGGCAGCGACTTCTCGACA
ACCGGCGCGAGCTGGAACGCTGGCAGCGTGGAGAACACGTGGCTCGCGTGGATCTCTTGTGTTTCTCCGCCTTTGCTGTCCTCCAAAGTGACTGTGAATG
CAGGACTTGACGAGGTTGTGTTCTGCTGGTGAACCTGAATCGACGAGACCTTGGTACTGACGTGGATCTCCGAGAGCGGATCGTTCTGTGTGAATTATAA
TCACGCAAGACGGGGTAGCATTAGAGCCAAAGGCCATTGTACAAGTACCATACACCCAACATACCTGGATATCGTCTTCAAGCGCCTTCATGAGCGACGA
CATGCCGTTCTGGAAGCTCACGCTGACCGACTGCTCGTGGCTGCGGATGAATTCCGACTTGGCGGACCCGTCGAGCAGCGTGTCGTCCGCGGTGCTCTTC
CCAAAGATCATCGCACGCACGACCGAGCCGCTCTCGCGCTCCATGTCGTAGAGCATCTTGAAGCACGAGCGCACGGACAGGCGGCGGATGTCGCCGCCAA
AGATGCCCGACGCCACAGGGTCCAGCAGCCGCTGCGCCACGAGCGGACTGAAGCGCCGCGCGGCAAAGTCGTAGATAGACTCGTCGTCCAGCTAGTCGTC
CAATCAGTCACATAGCACAAAGTTAACAGCCACCTTAGACGAGTCGTGTACATAGAGACGTACGGTGCTGGGCTTGGTGAAGAGCTCGTGCACGCCGGCC
TTGATGAGCTCCGTCGTGAGTGGCCACGCGAGCATCTCGCGGATGCTCGTCGGCAGTTTCTAAAGCGCAGTCGATTCACACACAACACAACAACAGTGCG
TAAGTCGTGTATCCAATACCCATTGTCATACAAGTAATACAAAAAAAACTACCTCAACATTGCCGTCGCGCAGGATGTAGCGCGACTTGGCGGCGGCGTC
CACGGCGCGCATCTCGCTCTGCAGGCCGAGCTGCTCGACGAGCCGCAGCATCTCTGCGCCGTTGCGCGACGGGCGGAAGCCGCGCGGGCCCTCCTCGAAA
AGGAAGTCGTCGCGCGTGGCCGTGCGCACCCAGCCGCCCACGTGGTCGGCGGCCTCGACGACNNNNNNNNNNCGACCCAGGCACTCGTGGTCTTGCCGCC
GAATATGTGGTCCTTCCACTCTGGGGAGAGCGGCTGCAGCGAGTAGTTCATCTTGATCTACTCGCTCGAACTTAGCATGTTGACGCCGAACGACTGCATG
TGTATCTCGTCCGCGTCGACCGCGCGACACGTTCTGTTCCACGTAGTTCGTGTCAGAAATCAGCGTGAAGCTCGACACACGCGCGCGGTCGATCAAGCTC
TGCAGCACCACGTTCGTATCGCCCTGGTAGCTCTCGAGGTCACCGTTCAGCACGTCGANNNNNNNNNNCCGACCGCGCGACGCGTTCTGCTCCACGTAGT
TCGTGTCAGGAATCACCGTGAAGCTCGACACACGCGCGCGGCCGATCAAGCTCTGCAGTACCACGTTCGTATTGCCCTGGTAGCTTTTGAGGCCACCGTT
CAGCACGTCGAAGCGGAAGAACTTCTTCGCCCGCCTGCACGTTCTCGATCTTTATGCCGCACGCCGTCGAGTTCTTCTTCATGAGCATGTGCAGGTAGGT
GTAGCTGAGCCACTCGCAGGCCTCGTCCAGATCTGCATCACGTCCAGCATGGTCAGATCCTGCAGCCATAATGGACGTCGCAGGTCGTCAACGTCCAGTT
GAACTGCTGGTAGTNNNNNNNNNNATTCATGCCGCACGCCGTCGGGTTTTTCTTCATGAGCATGTGCAGATAGGTGTAGCTGAGCCACTCGCAGGCCTCA
TCTAGATCTGCATCATGTCTAGCATGGTCAGATCCTGCAGCCGTAATGGACATCGCAGATCGTCAACGTCCAGTTGAA