Description :
From Genome Similarity Track
Location :
scaffold_169:41- 3645
Transcript NameFunction/comments
Pl_108362NA
Pl_108363NA

Sequence
3604 bases(100 bases per row)
AAGTTTCATCGCAAACGCAGACTGATAACTCTTGGGACTAAGGCTCTGAGCGTCAACAAATGATAGTTAGTTTTGTTGAATCGAAGGAACGTAAGTTAAG
TACGATTGGACTTTCCATGTCACTTACGCAGTACTACGGTTGAGCTCTCTGTATTTGGAAACGTACTCTCCCAAGTTGATAGTTGAGTACGTAGCTTCCC
ATTGCATTTGAGAAGGCATCACTTTGAAGAAACGCAAGTTAAGTACGATTGGACTTTCTATATCACATATAGATTGGCATTGCTAACTTCTTTGTATAGT
GGAACACATCATCCTTTGTTTTCAGCCTTGTAACCTGCGTAGATGCGGAGATATTTTTCTGGACGCTGATTGGCTGAGTTGCACGGCTATGTTCATTAAA
CACGTATAATTTTGCATGGTGATTGGTCAGTTCAAATTTCAGCTCGATATGACTTGAATTGAGTATGCTATGGAGTTTGGGACTAACGAAGTCCCGTAGC
CTTATTCGGACCGATCGATTTTTTTACCTATGTCCGATTTAAATCCCGGGTCGAAAAAGTGCCACTCCACAATACAAACTTCAAGTCATTAAGACACATC
TATTTTGAAAAACTCATCATGCCGCTTAACTATGGCAAGTCCCTATTTGAAGGGATCATCATGCCGTTGCCCGGAGGTGGGTGGCATCTCCCTATATTAA
CAGTATGGGGGATGATCCTCTTAAGGGACCCTAAACCCTAGGCCAAGGAGCCTGTTATTCGGTAGGCGTTGGTCTACTCGGGACCACAATACGTAGTCTT
CCATATCAAAGTTGGCTGGAGTACCCTTGTTCCTTGCTTTCTTTTGGAGTCGCTTTTTCTCCTTTGCGTCAGTCATCTCCGTATGCATCTCGGACAGCGA
ATTGCAAAGGTTCGTGAGATAGACTCCAGCACGACCTGCGTCAACTTCGAGTACTTGGTCCGCATCTGGGCATCCAGCAATGATGCCGAGTGGCGTCAAC
GGTGGTAATCCGGTGAATAGTTCTACTGGGGGATGATCACACAGTGACTGTACTGGGTATTGTTCAGGCTAGCCGGGAGTAGTGGCAATAGATAAGGCCA
TTCATGGTGGTCAAGTCCATACTCCAGAAGCAGCAAACGAATCACTTGCAGGACATCCCTGTTGAGCCGTTCAATGGTCCCATTTAGCCATGGCATATAG
ACCGGTGAGAGCAAAAATGTTTCACCATTTCGTTTCTAAAATGACTACCTTAATCTGACAGCAGCGTCTCTGATATGCCAAATCGCGCGCACCACACCGA
AAGCGCTTCCGCAGCTACAAATGATGTTGTTGTTGTGTTCGTCTTTAATTGCCAACGAATACGATGTGTCACCATAACCAGATCCAAGATAGAGATAATC
CCGGTTAACATCTTCATTTCGCTTCATGGCTGTCAGGAGTGGTCCATAAGGACGAGGTTTAAGACGTGGTCCTTTTACGTGTTTGAAAAGTAGACAATCT
TGTACTTGTTTCACCACTTTGTCAGATAGCTGGGAGATGTAGAAATAACGTTGGAGTTTGGCAATCATAGGCTCCTGACCACGATGACCTTGGCTGCCAC
AACGAGCCACGACAAAAATCCGAGCGAGGAGATCTTTTGCGGCGTTAGTGATCCATGGACCCCGATCAATCAGCACTATGCCACCCTCTACTTCAAAATC
GACTCGCAACTTCGATCGTTCACGGTGAGCCGCAGTTTGTGCGGCTCTGGTGTGCTCTAGTGTAGGAAAGACAAAGTTTTTGTCAGCGAGTGGGCGAAGC
GGGGAGAGTGAATCTACTGGGGATGTATAGTGACTGCGGGTCTGCACCACGGCCATGGAGATTGCGTCTCTGTCCTGCGAATGCCACCGCGAGACGATAT
CGCCCCAGAGGTTGATTTCCCCAGAGATGTGCTCAATCCGATAAGTTAACCCACAGAGTCGTATTGCCTAGCGTCGCAGACGATCACGAACATGCTTCTT
GAGCTCAATGTCCGGCGCGAAAATATACACCAGGTTTGCATGGTCACAAAATAAACGAAATTCGCGTTGACAAAATTTGTAAATATACCAGATCATTGTA
GGCTTTTGCAATCGAAAAGGCTTCGCGTTCAACTACCGTCTAGTTGAGTTAAAGACACCACCTTTGCAAATAATTAGCTCAAGATTTTGTTTGTGAACAG
GAACGCCAGAAGCCCAGTACTTCACCTGTGTCATCACAATACTGTATCTCGCGAGCGAAGTGTCGGTGAAAGTACACAAGTCAGTATGCGCCACCATCAC
GGAGTCCTTTATCAGTGAAATAACTGCATCATACGCTGCACGTTCAGTAGGGCTCTAACGCATAGCAACCAGCAACACTAGTTTGTTTCGCTTTCCGATA
CGTTTCTTTTCAGCTTCGTGCTTTGCGTGAAGTGGGGCAATGACGCGTCCGTAATCAGAAAGAGACTCGTGAAGCCTGTTGCTCGCAAAAATGAATCGCT
GTAAGTCCGTTACCGTAGCAGGGACTGGAAGATTGTTTAGAGCATCGAATCGGTGTGGATCGTGCCGGATTCCATCTCCAGATATAAGACGCCCGCACCA
CAAGATTTGTAGCTCAAACAGGGAGCTTTTAGTCATGTTCAACTTCAGATTGGCTTCCTTGACGAAAACATTCATGCAGCACTGGGACAAAGTCACTAGC
AGTAGGTGTAAATAATATAACATCATCGACATACGAGAGTAGTATTCGGGATGAGGGGCGCCAACACAATCTGCATCTGGGCTTGGGAATGCAGCGCGCT
ATCCGTGACCCCTGAGGAACTCGCTTTGGTGTGTAAACACCATCGGGTGTGACGAACGAAAACGATTCCTGACCGTATTCATGTAGGGGCAACTGCCAGA
ATCCTTGGGTCGAATCAAATCATGCGATAGCTTTCTAGTCAGCGAGGGATTCCGAGAGCAAGTCAGTCGTTGGTATGACTCTAGCAATTGGAACTGTGAG
ACGATTAACAGAGCGGTACTCGATAGTGAGGCGGGATTTGTCTCGGGGTCCTGGCTTTGGGACAGGAACAACTGCACAGGCCCAATGTGCAGCACTATTC
TGCTCCACTAGGCCATCATCCACCAGAGACTTCACATATGCGCAAATAAACTCAGCCTGGAGTGGAGTATACTTTCGTGGGGGTGGCGATACGGCTTTGC
AATTGTCTGCAACGTCACCTTCAGCGGTGCCACCGATGCTGCGGGCTCTGCACCAACAGCTTCACGCCAAATATCAGGAAATGGCTCCAACAAATCACGT
ACCGCACTGACATGAGCAGATGATAAACCATTTAAGACAGCTCGCTGTAGCAGCTCTTTAATTGTCGAAATGTTAGGGAGCGGTTGATAGGGGTTGTGAA
GCTCATCTCCGACCGGGATTTCATCCTCCTCGTCATCCAGCATAGTGGATCTGGCGAGCTGTGCTAACGAATGTTAAATGTCAATACCAAGGCGCTTTAA
TGCATCTTTTCCTATAGTAATTCGTCGCCATCTCCATCCATTATTAAACACGGAATAGCCGTGAGGTGGACAGGACCAGAAATTACAACAAGCTCGAGGT
CCAA