Description :
From Genome Similarity Track
Location :
Scaffold_2826:41- 2199
Sequence
2158 bases(100 bases per row)
ACAGCGCCAAGTGCTCCAAGAAACATGGAGCCACGAGGCGTGGAGATGGAGTCAGTGAAGGAAACAACTCCCATGATGAGTTCAATCAGGTGATCTGGAT
GGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCAATGATCCCGAGGGTACGGATCTCAGCCATATCGGATCTG
AAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCTGCCTCATGAGAGATCAAGCGTCGGATGCTGAGAA
GTGTTTGAAGTTTGCGGATCTGCTAGCGGAGCCAGCCAGGAACTGGTATCGCCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGT
TTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATAATACCCCCCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTTCATCGAC
TAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGATCACGTGGATCATTTCATCGAGACGTTGGGAGACGT
GGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGTGGTGGATCGCGCGAAACACCGCCAGAAGAAG
GCGGCGGTCGGATCTGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAAT
CAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCATCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACC
GGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGATGAGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGCAC
ACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGA
TTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTTGATCCAGCCCAGGCACCGAGGGATGTTGCCAGAAGTGCGC
CGAGAAGATGTTAAACTAGGACGCTCGCCGGCTTTGAATCCGGTACGAGCCGAGCGTTCTAGGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTA
GATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTG
CCAGATCCGAAGTCTCGTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGG
TGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGCATGGATCTGCTAACAGCAGAGTCCCGTGGGTACTGGA
AGTACCATGCCCCGCGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTC
TATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGTCGTGTACCGTACGAAT
GGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGG
ATTTCATGGTACCGGCCGGAGTGAGGTTTGGATCTAGCGGATGGGACACTTTTGTTTCCCTGACGAGATACGAATCCAGCTCAGCGGACGGCGACCGTTG
TATGGAGCGAAGATGAGGATTATAAGGGCGAATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGAACATG
AGAAACTGTGGGTCACTCGGGGCAAGAAATGGGTACCTAGAGTAATCCAAGGACCAGG