Description :
From Genome Similarity Track
Location :
Scaffold_5070:41- 1107
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_5070-snap-gene-0.0Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_5070-snap-gene-0.1Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_5070-snap-gene-0.2Cleavage induced predicted protein

Sequence
1066 bases(100 bases per row)
ATACATAGATGCTCGCGTTGATTGAGAACTCTGATTGATCCGTCGACTTTATTAGCGGCTGGTCTTCGCTATTGAACTTGACTTGGAGGCACTGCTTATT
GGGTGGGTTGAAGACAGTGAGACCCACGTCCGAGGCGTCCATGTGGAGATGAATGTTGCCTTCGGGAAGAGAAGCGAACTTGATCAGCGGAAGTGTTTGC
AGGCGACTGTACGCCAGGATGTAGTTAAATCACTGTAAGTCGAGAAGCGCCGACCCTGTCAGCGTCGATCAGCCAAAAGGAACAACTCGGTTGCACAAAC
TCTGTAGCTGCTGGTAAAACAGCTTTGTCGTTCGTATACACGTAGTCACGTGCGGGAGTCTTCCAAGAAGCTAAATTAGCTCAGTCATTAGCGCAGCCTT
GAGGGCATATTCTAGAGTCGTCCGTGGCACTTCTCGTTCTTGTCTTTATGCATTGAGGCTGCCTTGTTTATCGTGTTCCAGATCCGGTTAAGTGCTTGTA
GCTCATGCTTCCATGTCGAAAACGTGACTCGTTTATCGATCGTGGACCGAAAACCGCAAGCATCGCATGTCGTAGGCTTGCTTCTGTGAGTTGAGTGCAA
TGTGGACGGTCGAGCTCAAAGAGGATGTGGTCATCGACCCACTCATACCCAAAGAACTGCTCCCTGTCGTCGTGGTCTGCCATCAACGCAGGAGAGCTGA
TGCTACTGTAGAATAGCGGCGATCCGGATCAGCCGAACGGTGCATCCATATCGATGATGAGGGTGTGTAGCTGTGGGATCAGCACTTCCATTCTTGCGAC
ATGGTTGACGTTTGTCATTAGGTGACGGAATATGGACCCTGCACGTCGCCTTTCATCATCAGGATCGCCACACCAGGATAGAGGAGGGCGAGTTTCTCGA
TACGGCGCGTGAGAAAGAACACGTGCTCGTAGATCACATCAGTGCTGCATTCTTGTCAATCTGATCATTTGTAGAGAGCCCGGCCGAAAAGGAGAGGTCG
TGGATCAGGCGAATTTCATCTGTCGGACTAACATCCATCTTTCCCACAGCACCAAATGGACTGCAT