Description :
From Genome Similarity Track
Location :
contig_6:409969- 411363
Transcript NameFunction/comments
g2288.t1XP_009515188.1 hypothetical protein PHYSODRAFT_247606 [Phytophthora sojae

Sequence
1394 bases(100 bases per row)
GACCGCTCGCACGGTCTCGGGGCCGTACATCGCTTCAGCCTCTGGTTCGAGGGAGATCAGCGAAACGCACTGCAGCTGCGAGACTTCGTGCTCGGGCGTC
GATGCAGGAGACCGCTTTGTCATCGCGTAGCCTCGAAGATGGTACGTCAATCCACGCAGCATCTTGTGCTTGATCTCGGCTGGCTCAGCACGAGAGACCC
AAATCACGATGTCGCGGTCGGGCTCCACGTAGCGCCGGACGAGCTGCTGCACCTTGATGTCTGCGCGTGCATTCTTGGAATGCATCTCCTTGGTGAACTC
CTCGATGATCGTGTACGGGTCGTCGAGGTTCTGTTGGCAACCACAGTCCAAACGTTAGCGCCGCCAAAGTCATGCTGTACGTATCTTCGGCCTGTACTGA
AGCTCTTCGTACCTTTGCAGTCTTCTCGTAGATGTTGCCATTGCCGCGATGCTTCTCGGATCCCTCGAAGTGATCCCAGGTCGCTTCTGTCGCGGCGCGC
AGTCCGAAGGGCAGCACTTTGTTGGAGAAGGCCTCGAGATACTTGCCATCGACGCCTTCGCGAATGTGCACGTCACTGGGAGTAAGCACCATGTTTGCCA
AGCCATTGGAAGCGAACACGGCATCGACTTCTCGACGCGCAGTCTCGAGGTGGCGGAACAGCAGCGGGAAGTCGCCTGCACCACCGCCGCGGGAGCTCAG
CACGCGCACAGTATGCTGGTCGGAGAAGGCCGTAAAGGAAGAACAGTCGGTCGTCTGCAGCACAAGAACAGCAGCACAACACGTTAGTGCCAAGTCTAGC
AGCCACAGCAACGTCGTGACACATTGACGCACCAAATGACTCGCTCGCTTCCGGACCACGTTGGTCATACAGTTCGCCACCGCCTGCTGCCTTTGAACCG
CAAGCTTCAAGCGAAGGTTCTCGCGCTCCGCTTGCTTTAGTCGGCGTTGCTGTCGACAACTGATCTCCTCCCAGACCCTGGGCAGTTGCAAGGCCGATTC
GTCTGCTGTCTGCTCCTGTGCGGCAATTTGAATAGCTGCTGGTTGTCTGCCTTTTCGAGTCTGCAGAACCTGCAGGTCGAGCTGGAGCTTCTCGATTCTC
TCATGAAGGTAGGCGATCTCCAGCCTGCTGTCTTTGCTCATCCAGTTGGCGTCTCCGTAGATGCCAGCCTTGCGCAGCAGCTTCTTCCTCTCGTTGATCT
CTGATCGCCGTCTCAGCTTGTCTCGACTCGAGCTTCCGAGCCTGTGGTCGTTAGAGGAGACCGTCGATGCCATCTCGTAGCTTCCTTCAACTCCGAATGA
AGTCTCGACGCCAGTGACGTTAACCGACGGCTTTGAGCCGCAGGTCAGCGCGGCCCATTCATCCTCGCCCTGCGTCAAGGCGGCGGTCCTCAAC