Description :
From Genome Similarity Track
Location :
Scaffold_38:409905- 412518
Sequence
2613 bases(100 bases per row)
TGAGCGATGTCTAAACCCAGTGGAGATGATGATACCCGTGTCACTAACGGCAGAATATGATGATACAATGATGGTGATGGAGATTTGGGAAGCTCACGAT
GGATATCAGAGTGAGTTTATCGGCCATGGTCGTGAACATATTCACAAACTAATCAGGGAAAATTCGCTGGAGATTCCGTTGACATCAAGAAGTGGTAAGG
CTTCCTGTGGGAAAATAATTCTATCCGCAGAGTTACATCGACACTCCGGGGTGCTGTCGAGTACGCTCCTGCGAGGATTCAGCGTACCTTTTCAAGAAAA
TGGTGAGCAGGCGACAGATTTGATTGTAGTTATGATTTTGGAATGCCAGGGGCTACCACGAGACTGCAATCCGGTTGTCGTGGCAATCAAAAGTAGCCAA
TCTAACACACTCATGAGAACGGACTGTGCAGAGTTTGATGATAAACGTGGCTCCTTTGTGTGGAATCATCGCTTCTGCTTTGAAGCGAGGCAAGTAAGCA
TGCAAGATGAAAGCATTTCGTTAGCTCTTGTTCTTGAAGACGGCGTCGAGAACCGGCCTTTGCAGGAGGCACTTGGAACTGTTATTATTCCGTTTGATGC
GCTGAAAAATGGCGATTCAACATTTTGTGCGTGGGTTGCATTACAACCAACTGCTACAATGGAGGCGCAATTAGATGTTCACATTCGTATTATGTGCTGC
CTGCTCATAGATAGCGCACGCAACAGCGTGGTGACCGATTCTCTGGCCACTACAGATGTGCCGAACTCGACTTTTATACCCTCTGTTAGAGCCGCGGATG
CGCCAATTGCTCTTCCTCTTGGAAGCCTGCTGGAGATTAAACTCGTGACTATATGCGCGACTACACCCGCCGAGGTCGAATTTCTGCGAGAATTATTGAG
TTCATGTAATGAGGGAGGCGGGCAACTCGCCATACGCGGACGTCTTCAGTTGACTGATGGAAACTCACAACGAAGTGCCACCAACGCTGCTGTTAGACCC
GACAAATCGCACTGTGAAAATCAAGTATGCGTTCAGCTACATGCTGACAAAGATGATTGCATTATCCTTCAATTCGAACTAAGCCCCGATGTGGTGACGA
ACGCACAACCCCAACTTCATGTCGAGATACGTTCACGAAAATCTCAAAAGTGGAGGATGTCACTCTGGATAGCATTGTCGTTCGTGCTGAAAACGCTTTC
CGCAGGGATGGAGTGTCAGTGCAATCTTCCTCTTCTAGACCAAGAAGAACGCACATGTGGTTATCTTGGTGCCAATTTTCGAGGTGGATTGCAAGCTGAC
TTCCTGAATAGTGATTTGTTGTGGACTCCCGTCGTACACAAGCCCAAGCATTGTTTTCTCAGTGTGAAAGGGATAAACCTGCAAGCTTTAGAAAGCAAAA
GTGATATCAGTTGCTTTGCAAAGATCTGGTCGAGCGCAACGGGCAAGTTCCGTGCTCAACTGGTATCACCTCTAATGTGGAAAAACGGCGGGTTTGCTTC
TGACGAAACGAAAGCTGTGTCATTGAAGGTACATGATGCAGAGAGTGAGGTGGTGTTTGTGGGCATCTATCGCTTTAGTACTGTTGAGAGAAACGAGTTG
ATCGGATTTGGTAGCTTTAGTATCTCGCACGTTTTGGAAGTAAACGGGAGAACTGAAAATCTCGAAATTCAGCAAAGTGTGCTTCTGTATTCAGAATCTC
CGGGTGAAAAGAAGGAGTGCGGGTCAGCGATACTTACACTCCAAACAATGAGCGCCAACAACGAGGAAATGGATTGCAGCGTGTCACTTGCTTGTACAAG
TCTAGGTGGGGTAGCGTATCCTGTTCGAAGTGGCGAAATGAAGTGTCGATTTGATGTTGGCATCCTTAAAGTGCTTTGTTTACCAGTACAAATATTAGAA
GGCGATACTATCACTGTCCAGCTTCGGATATCGCAGAGCAACTGGAAAACAGAGCTAGGCCCTGCTAAAGTCATGCTTGGCGATGACGGAGCAACTACAT
ACGTTTCGGTAGGAGATAAGGCGAATGCTATTGTTTGCTGGTCGCCGAAGGACCGAGCCTTCCCTGTACTGGAGATCACTTTATATGTACAGCATCAGCG
AAAGCCGAACCGGTCAGGGATTATGTCCAGTGCTTCCCTCACTCCGAGTGCACGCGCTAGACGCCAAATAGATCGTCAAGCTACCAATGAAGTGCTAAAA
CCTGCATTAATGGCGACTGGCAGCCTGAACCTGTCTTCATTCTTCTCACAGCTGAACGTCTCAGTGCACACTGATTTACAGCTAGTAGTGGGGAAAGCAT
TTTCCGGCACGGATCCTACGAAATATGAGAGCGTGTCATTGCTAGCTACGCTGCGGGCATCATCGCACCTAGAAGATGGAGCCAAGTCTCCAACTTCTTT
GGGCGCTTTGGACACTACACCACAGCCTGTTAAGGGGGATATATGCATTCATCTATTACACGCTACCGGCAGCATCTTGAGAAAGACTAGCTCTGTTTCT
ACTTACTACGTGCTAATTTCTTCTGGTGCACAGCAGATAACTAGCAGGTACGACATTGTAAACTGATTTTGTTTGTGTAACTACTAAGCTTTTTTTTTAT
TGTTTTGCAGCTG