Description :
From Genome Similarity Track
Location :
Scaffold_1347:4098- 7942
Transcript NameFunction/comments
Phyag_g10354ser/thr kinase

Sequence
3844 bases(100 bases per row)
CTGCAGCCACCAAAATGGCTTGGAGTAGCTGGGACGCAATTTCCTTCACAAGAATCATGCTGTTCTCGTCTTGTGCGAGCGCGTACACGATAGGACGTAG
GTTGTACTCCACCAGGAACTGGATCGGTGATGTGTGGGACTCGAACAGGCTCTTGAGCATTTTCAGCAAGTTCTTGCGCACGATTGCCTTCGGAATGAGT
CGCAGGCGCTTCAATATTTCCATCACAAACATGCCGCTACGTCCAAGAGCCTGGTTCAGCCTCACCGAACGGCTCATAATCTCCAAGAGCGGCTCTAACA
AGTTCTCCAGGTCTGTGTCTAGCGCATTGTGAAAGCATACCATGATTTTCATCAGGTTCTCAGGAACGAGTAAAACGTTCTCCATTTTCACCGTGTCATG
TACAAGCCAGACACTGATGGACTTGATAGCATCGACCTGCCAGTATttatcttccagcagctccaaaaaGAGCGACACGCTGTCGTATGTCCACAAGTGA
GCTCGTGCTGTAGGCGACGCGTGAGCGAGATCGCACAGGATTGGAAGCGCAAACTGTTTGAGAGGGCTTGAGTTTCGCACGACCTTGATAAGCGATGGGA
TAACGCCAGCCTGTGCCGCGTGAGTCTGCCGATTACGGTTGATCCGACAGAGATAGAACATTGACTGAAGCACAATGTTCTCGACCTCTTTCCGCTTCGC
ATCGGAGATGGAAGGACCTTCCGCCTCCTGCTCATTCAACAGCCGAACGAGCGTCGGAATCGCTCCTGCTCGATCAAGTTTCTCCAGAGTTAACGGTTCC
ATGCTGAGATTTCGAATGCATTTGAGTACCTTCACCATAGCCGAAACAAACTCGTCCGAATGGCGAATCAAAGGCAGTGTCCGCTTACTTTCATATTGCT
GTTCGTCAGAACCAAACAGCGGTGCGCCAGGGTGAATTGCTTCCAGCAGGCCTTCCAAGACAGCACCGTCACACATGTGTTCTTTCACCACTGCATCTCC
TTGAGAAAACAGTACGAATATGTCACATGTCTTGTGAAGTTCCTTCGTGGTCCACCTTGTCGTCGACCCGCATTTGCCGTCAAGCACTTGGACGCTTGGT
CCCGCAGATGTATACGAATTGTCATCGTTTTCCGGGCCACGCATATCGTTTGACGCGACAGACACAACAATctcggagaagacgacgacaaactTCTTCA
AAAGCCCCGCCTTCACGAAAAGACGGCAAATGTCGTTCTTTGGGATGGTCTGGATGCTGAACACGCTGAAGATTCCATCCAAGGCAATCCGAAGCAGGCC
CACGTCGTCATCAAAATTAGCTGGCTTATTTTCAAGCGTCAAGAAGTCCACAAGCACGGGCAGCCCGCCACACGCAATGAACATTTGCAGCGTCAATGAG
CTCGTTTTGCAACACTGCCGCACAAATTTCGCTGCTTCCATCCTCACACCGATCGAAAACGCATTGTCCTCTAGGCCATCCATGCGGAACCCCCTCCCAC
TTCCACCAGGCAGGTAATACGGATTGTGCTGCTTCGTAAGCTTGATGATTACTGGTACAAGACCGACCAATGCTAAGTTTTCTTGAAACTTTTTGTTGCC
CTCCACAATCTAAGAAAATTATTAAACCATCTGTGAGAAACACGGATACAGTGTCGTACACATCAGCGAAGGGGGACTTACAATGTTGATTACCCTGAGT
ACGGCGTGGAGGacgtccatcttcttcatttccaGTGCCTCCATGATGTTAGGTACCACACCAGGTTGTGACATTAAATCCCGCCTCAGAGTCACGTTCT
GGTCAAACAGTTCCTCCTACAGAATGATAACCATCGCTCTGGTCAGATACTACAAAGCCTCAAGTGCCAAAAACATAGAAGTGCAACTCACCAAATTATT
GCAAGCATCAAGGATGACTTGGTCTTCCATGCTCGGGTCCAACAACGACAATAACTCAACCACTCGACCAGTTGCTTTTTGGTTCGAGTCACGAGAAGTC
GAATAATCAAAATCCAACTCATCGTCAAACAAGTTTTCTTGCGCACTCCCCCCGGAAGATGACCCCACATTACTTCCGCGATTGCCTCCAACACGCAACA
CCAAATTCCCAACCTGCCCTTCAGCAAATTCGAAATCTCCATCGatgtcatcatcgtctttAAAGGCACTCAATGGCTTCTTAGCTGGGACTACGGTGTC
TGGGGTGGGTTCCATCTCCATATCGTGCCGCTGTTTAGCAGCTGCTTGGAAAAGCTGCTTCTCATCAATATCATCAAAAGCAAAGTCATCTTCGGGGTCT
TCAACAAACTGCTGGAGCTTTGCAATGCGACTTTGAGCAGGAATCAGCGACGATCGGTCCCACGAGTTCATCGAAGGCTTATCGATTTTGCTCTGGTTTG
TGCtgatgacgctgctgccatgaCTAACATCCAACAGCGTCGTGCTCTCAGACAGCACTGAAGTTTcaggttcttcatcgtcccaGACGTCATCGTCAAA
CAGCGCGTTTGCATCTTCTTTTGACAATTGAAACTTCGGTTTGCTCGGTGTAGTTTCTGCCGCCTTCTTTGGTTTACTTTCGTTCCTGGTACTGTCGTCC
CTGAGCACAAATGGTGTCGGGTTTGTATCCACGCCGAACTCATCGTCCCAATCTTCAACGTCTTCGTCTGACTGCTCATTTGTTACACTGAGGGAGCGCG
AACTTTTACCCGCCacagttgctggtgcttctaTTGTAGACGAGCTTTTCTCGTATAGTTTGATCGTATTCAGCACAGCATCGCGATCGTTGGAAGAGGT
AACGCTCTCCGCAACCAATTGCGTGCTCTGCTCGACCTTGTTCTTCGGAATCTGAGCGATCCACGGATGTGCTAGAAGCTCCTCCGCAGAAGCTCGCAGT
CGCGGTTCCTTCATGAAACACTTCATGATGAAATCGTGCAAAGCCTgcaacaataaaaaaaattTAGCATGAACACACAGGATATTATTCACAGTACCAA
CGTGCAAGGTCTTTACCGGTGACATGCGCtgaggaagtggtggatgatcttcttgaacgaTCCGGAACAGCGCAGCCATAGGTGCTAGGTCAAAGTACGG
CGGCTTGGTCGTCAACAGCTCAATAATCGTGCAGCCCACGCTCCAGATATCCGAGGCAGAAGACCAGCCCGCCATTTCAATCACCTCCGGCGCCACTACG
ACACAATCACCAATCAATCAGCACCATTCAACGTGGTAGAAAAATAAAACTCAATAGTCCACAGCATACTCCAATAGGGCGATCCCACAACACTGTTGGC
CTTCTGCGTCTCGTTCAACTTGATGGCGACGCCGAAATCCGCCAATTTCACGAGTCCGTCCTTGGTCGTCAAAATATTTGCTCCCTTGACGTCTCGATGC
AGCACACCTTGCTCGTGCAGATAAGCCAGTCCCCGCAGCACCTGCGTGATGTACATGGCCACAAGCGTCTCCGACAGAGACCCGAACTTCTTGATAAACT
GCGCCAGCGAGCCGTTctccatgtactcgagcacAATGTACAGATAACCCTGCGTCTTGATGGTGTCGTGGTACTTGACGATGTTCTCATGGTTTAACTT
GCGTAGTAAACTGATCTCCGTCTGCCAGCACGTTAACACAGCACATAAAGTCGTCAGAAACAGGATAAACAAAATTATATCGTCTTCTTATCCTGTATAT
GTGCACCTCgatcgacagcaactcgtccTTGTCGATATCCCGCAGCGACACCTGTTTGATGGCCACCGAGCGGCCGTTGCGCAGGTCCAATGCTCCATAC
ACGACGCCGAAGCCGCCGCGTCCGATCTCCGCTCCTAATTGGTA