Description :
From Genome Similarity Track
Location :
Scaffold_4:40977- 46139
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_4-snap-gene-0.37Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_4-fgenesh-gene-0.19Nucleoredoxin
Pytap_DAOMBR444maker-pag1_scaffold_4-snap-gene-0.6050S ribosomal protein L22
Pytap_DAOMBR444maker-pag1_scaffold_4-fgenesh-gene-0.21Kinesin heavy chain

Sequence
5162 bases(100 bases per row)
CATGTAACGATTCCGCTCAAGCCTCAAGAGAAACCAACAGCGTTTCCAACCAACTTTGCCGACACATTGAAAGAAGAGTATGCGATCAAATATCTACAGC
GACTGGGTgCGCATCCATCATCAGCAAACATTGAAACAGTCCTCAAGTATTTGCCCCTCGACGACTGTCAGATCACGACAGCCTGGAAGGCCAGGGGCTC
CCTCTCGGATGCTGTAATGATCGATTTGTACCCCAAGACACAGACAAGTCCGAGGGCAGTTAATGGTCAGATCCCAGAGCAGGAGGTCGAGTATCCACAT
CAACGTAGCCATCCGTTGGCGGACCAAGATAATGAAGGATCATTTGCGACCGGGAAGCCGTATCATGTGGGCAGCGTGTGCATGTCGTTCGATGACATGA
AGAGAGAGTTTCTGCTACCATTTAAGCACGGAACACGGCAAGAGGCTGATGTACTAACGATGTTTGCCATGAAGCACGAGGAACCTGTTAGCTTTGTGCA
CATTCCGGCGCTTGCAGAATTCCAAGTCAAGCCCATGCTACAGCTGTTTGGtCGGCGAGCTACAACGCGTCGAATCAAATGCATTGAAGAACGTGTAAAC
CCGCCAGACTTgAaGCCAGAGTTTGTTCCGTACATGCTAAGAGCTTTtCATGGCGCCCTGCCATTTACATCGCTCGGAATGCGAGGAGATCACGAGAGAG
ATCTTCTACTGGGCATGCTTCTTGAGGACTCTATGTTGGATCTTGTGACGGCAGTGGTCAGGTATCTGTACCTGGAGGTCTTCTTcAAGTTGGGgTGCCT
TGGTGCTGCCGATTTGATTAAAtCTTCCACCCTCCAGTCATATCACACGACGGCACCTGCTGAAATCGAGTCTCTTTACGTTCTCATCGTCAGCCTCTTC
AAGAAGATCAAGCAGCGTATGGAGCGAGAAGAgAAGGGCATCACTCTCTACTTACcACTACACCTCCTAGCCTTGCGGGTCACGGTCGATACAGTGTTCA
GGAACCAGTACCCCGTGAGCTTTAGCGTCACCACACCTACCATGCAGTACATTCTACAACATATGGATGAAAAGCTCACCAAGGTTCTTGACTCGGACTT
GCTTCTCAGTCGCATCGGGACCCTAGAGACGACTTGTGAATCGTCCAAGATCATGGCTTCGTCTCCATTCCAAGCTCGGAAGCGACATACGCGGTTACGC
GACCAATACTTCCAGACGAGTGAGGCTCTCCACACGATATTTCCAGACCCTCTTCCCGGGAAGTGCCTCAAGATGATCAAGTTTCGTGGTGGCGCAGCAA
TCGCTAATTACCCGATCCCCGTAGCTCCCCCACAATCCGATGAAGCTGTTGCTCTTGCTTCAATGGGTTCTCGCAATCAAACTCGAGTTGAAGAGCCTCT
AAACACAAGAACGGCGGCGTTATCGCGACCATCGCTCGCAGCACGTATGGAGTTGTTGCATGTAATGGAGCGCTCTCTCAACACATGCGTGAACACTCGA
CGAGCTGAACGAACaCATATGACTCGAGCGAAGACAACACGATGAGAGACTAGGTACAAAAAaTATATTGCGGGTTATCTCAGAAGGATATCTGTGCTAT
ACATCGCCGGCTACTGCCGACCGAATAATCACAACGCGAAGCAAATCTTGTGGCCAAACGCTTAAGCGGTGAGCTTGCCCCAGAGCTGCTCAACGTCGCC
CTGAGCCTCAGCAACCCACATGCGGCCATCCTCGGTGATGAGCTCACCCTTGTCGTTGAGGAAGAGAAGCGTTGGGATACCGCGCACGCCGTACTTCGTC
GAGAGGTTACGCTGGGCCTCACGCGCCTCGAATGGGAGGGCCTTAAATGGCATGTCGTTGTAGTACTCCTCAAAAGCCTGGACGTTCTGGTCCGAAGAGA
CGAAAACGAGCTCGAACTCTGGGTGCTCCTCGACGACGTCGTCGTAAGTGGCGCCAAGGAATGGCGTGAAGGCACGGCACGGTGGgCACCAGTGAGCCGA
GAAGTAGAGGCCCACGACCTTCTTGCCGGCGAGCACCTCGTCAGTTGGCTTGTtGCCGTCCTTCGTGCGCAGCTCAGGGCCAAGAATTCcGTCcAGATGC
CCATAGTGATtGTGTCGAGTGTCTGACTTGGCCAAGATTGGATTGTGGGGACTGAGTGGATcTCCCCcAAGTGACCCGCTCgTGGgTGCTGAGAAATCGG
CTCTTGTAGGGAGAAAACAACAACGTCAACCAGCGAGGAGGGCACGGAGTGGGTCAAAAGTTTACGTAATAGCGATGACTTGGAATTTCTATGATCCAAG
ATTGGAGGTTAGAGGAGGTTAAGTGTGACGGGACCTCTACTCCACTGTTAGTTTCGGTAGGGAGAGAGATGGATGTTAACGTGTGTTGGCGGATGCTAGA
GGAAGTGAGATGGATCGTGGAAACTGGGAATAAAGAAGGCTGGTTGATGTTGGTCGAAGAGCTTCTTCGGATGAGCTTCTTCAAGAAGAGATCGCAGATC
ACAGGAGCGTGGGAATGCCTTTTGATGACGATGATGGAATATCGGCCCGGTTAGAAAGTTGTACTAATAGTTCTCTCAGGTGATCAACCCATGTGATTTG
AGTTCTGGTCTGTGGAAACCACCAGAGATGACAAAGGTAGAATCAACTCTGCGGGTTCATGTCTGAGCGTGGGTACGTCTGGTCTACGTCTATTTATTCA
TCCCTGGCCTTGGTGGCCTCCTCGCGAGCGAGTTTCTTGGTGAGGAAGCGGTTCAGCGGCTTCTTCGACGGGTCGAACTCCTTAAGCACCACGGTCAAGT
GCGAGTGCGGGTGGTGCATGACACCCGAGCGGCCTGTTTGATCAAGATATTGAGGCATGCGTTCACTGATGACAGCAAAGTAAAAGGCTATGAGACGCAC
CTCGACCCATGATGCGCAGACGCTTGAGGTAGTGGCCCTTGTTCACGAAGCACTCAGCGACCTGGAGGTTCTCCGGCTCAATCTGGTACTTGATATCAGC
GAGGTTGATGGCGTTCTGCACGGtCTTGTGCACGATCTCAGCCTTGCGCTTTGGCGAGAACTTCATCTGCAGCAGCGCCTCCTTAGCAGGCAGACCACGA
ATCTGTTCAAGGCGTCATTAGCAAACCATCGCGCATAGTTTCCCTGAAAAACGTCATGTGCCTACCTGCTGCGCCAGGTAGGTTAGCTTGCGTGGGCTGT
AACGGatGTTCTTCTTCATAGTCTTGACCTCACGCGCATCCTCTGGCTCGGTCGCGTCAAGGAACGCGGCCGTGGCGTCCTCCGAGACCGTCGACGCCGA
CTCGGAAGCAGCCGTCGAGAAGCTCTTGAAAGCCGTCATGCGCGCACCATTGTTGCGCAGCGACAAGGTCGCCAGTTGCGATCGCACAGCGCTCAACATC
GTCGTCCCGCTTCGCTTTGCCGCCACTTTCACGTGATGCCGCAGCCACTGCCACACAGCCGAGTCGGTCGGTGGTGGAGATCGGGTTGTGATGGCAGGTC
GATATCAAGTTTCGAAGGTGTTAATGGTGTTAGAAACCAAGTTGAGTTTCTAACGAATATTAAACCTCTCTGTGGAAAGCACTGCTTTATGGGAAAAATA
CGGTCTACCATGTCTACTATCATGGCCTTAGATGCTCCCCTCGCCTACAGGTCGCACTGCCGGATAGGCGGCTAGAGGGGAgTAGTTtAACATACGCTAC
ACACATTTGTTCTTGGGGCGCACGCTCTCACATGAATGGCGAGGCTGTGCGGGTCTTCTTGTCAGATATCCAGATGCGGAGCCTCTCGAGCTCTTCGATT
GCTCCGCTCGCTCGGTGCCCGACGTCAATGATCTCCACACTCTCTCGTGCGATCGCGTCGTCGGGTAGCCATTCAATGTTCACTTCAATGTCGGTACGGT
TCGACACGAGAGGCATGAGCTTCCCGACAAAGCGCTGCCGACTTGTTGCAGGCAAATGCGGGATCTCAATACCACGCACCGTGATCTTGCTGGGAGCAAG
GCCGTTGACAATGTCGGCGATCCACGCACCCATGTATTCAAACTTGTCAGGTCGTCCCTTGCAAATGTCGCGACGCAGAGACAACAAGAATTCGGCTGTA
AATCGCTTGCATTTCTTCATAAGTCGGAATTGCACGAGTGCCTCGTTCAGCATCAACATAGCTTCCGTGTTTTCCATGCCATGCGTGCCCATTTCGTAGC
ACTCGGTACAAAGGTTGTAGTTGGGACACACGCTGCACGTCCAAAGCGCACCcGTAATCGATTCGACGCCACAACCTTCACAAGAAATGCCCTTGTGAAC
CGTCGACTTCTTGCGCTTGAGCTTAGAGGCCATGAGGGAACCACCATAGCTGAGAGCTGAGGTGAACTTTGCCTtGGAGAATCGTCCTCCCTTCTTTGGT
GCTGTAATGGTGCTTTCAAAGGTGGTGTTTCGATCTCCcTCGCTGGAACGCGAGTCaGATGAGTCGGCACACGAGCGTGCGAAGAGAAAGGTACGAGAAC
CGCGTTGGGACAAGAGCAGATCCTCGACCTCTGTCTCCGTCATGTGTGGCTCAATCGGATGATCATTGATGCTAAGCAGCGTGTCGCCAACGACAACACC
AGCCTTGTATGCTGGTGAGTCGCGCTCGACGGAAGATACGCGGACAGCAAGCTCAGCGGTTTCCTCCGAGATGCTCAATCGTGTCGTGATACCCGTTGAG
TTGTTGTCACTGAACGTCACTTGATACGAGTTGAACGGCTGATCCATTGAAGGGGATCGTTGGGATCCGTTGAGAGTATCTGTGCTCGCTGCGGACGACG
TGCGATGCGATGCAAACGATGCACGATTCGCAGACACTTCACTGGTAAACTTGGGGGgCTTTGCGTGCACCTGTACACGCCGAAGTCCATGGAGCGCCCT
CGCCGACGCGTTTTTGCCTGGAACACTTGGTCCGACGAAGCGGTGGGACACATATTCGTCATCTTCGAACTCACCGAAACCTGCTGGGGCGACACCGAGG
GGTGTGCCTAGTTCGCTGCCGCTGTCGAATGCTTCATCGTCCACATCGACATCGACATCATCATCGACCTCCGTGTCATTCGGGGACACCGCGCCGGTCG
TGCGCTGCTTCACAGGGTCAGCGATGCTGTCACCATGGCTCCCGCGGTCCGTCGAGGGGATC