Description :
From Genome Similarity Track
Location :
Scaffold_295:4097- 5400
Sequence
1303 bases(100 bases per row)
GAGAGAACAGAGTGAAACAGTCTGAGCTATTGAGATAACATCAGTTCAACGCTGCTGTTGCCGGAACAACGCCAATGCGTCGAGCCGAAACCTTGAATAT
TGACATCTCCAAGTACAGAGGAGTCGAGGGAGATTTCCTGTTGGGATGTTTTGTCGAGGTGGATGATGCCATAAGGGCTCGTTATATCTTTAATAAGCAA
ATGCAAGTTACATTTGCCCAATCGAACTGAGCAGTACGTGCCAAAACTTGGGCATTTGGGCTCAAGCTGCACGATCCGTATGTCTCTGGATCATTAGAAG
GTTTCAAGACCCAGCTCACACAAAGGTTTGAACCACCGCGAGCTGAGTTCAGGGATTGATCTGAGCTCTTGAAACTCAAGCAGGTCAAACGTGATGTACA
CGCTTACGCCCAGCACCTACGATCCCCGCGAGTAGCATTACGGGCAACCCGATCCATGAACACACGATGATTATAGTGTTTATCCAGGGTCTTGCGGATG
GGTTCGTCAAGATCCACCTGTTCCACCTGTAACTCGATACGCTGGAAGAAGCGCTGTCAGTGGTAGAACATGAAAACTTTAGCTTGATGCAGGACCATGC
TAGATCGGGGTTTTATCGTCCCCAAAATTTCAAGTGGTCGGATGTACAGAACACATGGGCCTCTGTTCCATGAAGAGTAAGAGGTCTCGATCCCCTGACT
TTAATCTATCAAATAGGTACAACCGCTGTCAAAAGACGGACTATTATTCTTACGAGTGTACCGCTCCGAACATAGCACCTCGTACTACAGTTCGAAGTGA
CCGCCTGCTGGCCAAGCAGGGCTTAAGACGCGAATCCAACGCTGTTGCCAAATCTCAACAGCGAGGCTTATCGTTTAAAATTGGTCGGGGTCAGTAGGGC
GGAGCACTCTGCTGATCCGGCGACATCAAGATAATTAGCAAGTCTCTTGCGCAACTTGATCCTAACGCGCAGTCACTGTGATTTCCCGCTACTTGTGATG
AGGAATACCTCATCACCTTGAAAATCGAAGTGACGAAGGATATGTAACGTCGGGGCGTTTTCTACTGTTGGGCGTCAAACAATTTTACTAAACACCAGTC
ACTAAATGATTGTATGATCAAGTTCGTTGAACGAGAGATCCCTCCAAAGAGGATGACGGTGTGCCTTGCAGCAGGTGCATCTGTAACAGTAAAGAAACAT
GTAGTGGGAATCCGTTACACGTTAAAAGAGATTGAGTGAGAGGTGATTTTACTGTACTAGAATTGGATGACAAGTATGATGTCACCCTTGTTTTGCCATG
TCT