Description :
From Genome Similarity Track
Location :
Scaffold_18:409616- 414206
Transcript NameFunction/comments
Phyca_LT1534110564LOC100283716 putative
Phyca_LT1534545538protein kinase putative

Sequence
4590 bases(100 bases per row)
ttgctgccaaccaaaacaacttgaacggctcatcatggcaccaactgcaggtgggtcttgctgctcctgggctgttgcatctctctctaatggctttaca
gttatcggacgtattttgtaacatctctacgcttcttctctgtattaggaacccgtctgcgctttaagaactcacgctccaagaagacgcaacaagccaa
aaaggttccatcgctcaagaaccgcatccgtggcctcgaacgctttctcagtcgcggggtatgttcaccaccattttgcataataacaattttgcaatat
ggtagtttaaagatgactggatatttgtagggtctggctgatgccactcggagagcaaagaaggctgagctcaagcagctgaaggaagaggtgagtgggt
ttgcttgaagttaaaaagcccatatcggtagctaaagcggaaatgatgttattgttacgacagcacgagcaaaaggagaagnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaccactaactgatactat
gattttacttgctagccgcgctttttcgagcgtgtcaaggttatgcgtaaactgcgtcaagctaagaatcgcattgaacaggtggatctgttgttgatgt
ttctactctagttgtacgcaattctgacttaactgttgctgcaggcaaccgacgacgccgaacgagctgaacacgagaagaagtttaagacataccgcga
ggaaatgatgtacatctactactaccccaagactgagccgtacattgcgctttttccgtctgcaccccactcggaagagaaccagnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccaaatcta
ccaatgaagccaggcctgctgtggaactgctgctcaagaagcccacaaaggagcaggtgaagaagcaagcgaagaagcctcgtagcaagcgcgacaagtc
aggtgaaaagccgaaacacaccccagctctcgttgaccaagatgacgacgatgaaatgtcggatgcagcgaagagcgagagcgacaaagaggagcaaaca
gaagagcaggaagaggacgatttcttcctttgatcttggcattaatacgtcggctaaactgttcaccgctgttgtacttttgaaggccatggttcttgaa
atttattactaatagtctttacgctgacgagctcatatgggaaatggataacttggtcacaaaagaataaggctggcgaaagatgaggagaaatctggag
atgtcgttcgagctagatcaggatggatgggccgcccggagttattgtttcctgctctgcgtcagctatcatctctgcttcagcttgagatgcagcagca
agagcattcatgtttgtaaagctgaaagatctgaaggcatctgaaaggttggaatcatcggggctaccgtacatgccactagggaaccgaaagtgactgt
tgttgtcttccatctgcacaccgtcaaccacgcattcgtcatcacgagaagcgctcgctgcatcgagtgcacctaaagcccctgcagtcccccacgacga
gtccgggccacctagagcccctgctgccccccacgacgagtccgggacatctaaagcccctgctaccccccatgagatgtcaatatctgaggtggagact
gaactgtcgttgttgttctcgtcattatcatcctctcctttcgggtcagatgagctcagcgactggacatcgctctcaggtccagaatcaacgttctgac
tgctgcttgccgaacgagtagaaacgttgaactcatcgtcgtcaatgaaaatgtcggtaagatttcggttgttgaaatagctggtatcgttgggtccctc
aagagtcggcacaaacggaggcacggagtccaagatcgtgtcccagttgataccactgaagaaaggatgctgcttgatattctcccaacccatacgggac
gccgggttcggatcgagcagtttgtctatcaaatccactgcctcaagtgacaggcacttctcgccgtcgggccatagaatttggcgtgctataatgttct
cgaagatggcgtcgacagagtcatcattaaacggcggaaagccaaccagcatctcgtacaggatgattccaagtgcccaatagtccacaggggggccatg
aggaactccaagaatgatttcaggtgccaggtagtcaggggttccgcatcgtccgaacgtttggtaagcagacttctttttcgagctcctagagattcgc
cgtggacgaataggtgggaaagcagaagtcatgtctcccagaacgtctggtatgccaggaggtatttcggggtcctgggccatggactcgtcatcgggtt
cagaatcggtgtcactaacagctacagcttcctcggacaagccgaaatccgtcagctacgaaaaaatacggcgactaagataaggatcgaggtagaagga
attatagtccagctgagcgcaccttaatgtgtccggtggaagaaagcaaaatgttgtctggtttcagatctctgcaaattataaatccaaacgaggttgg
atgagttggtatgcaaacaatgcaaccgaaacaagttaaagagcaatccaacctgtgaacacaactcttggcgtgtaggtgattgagcgcgattgcaatc
tcagcgatatacacgcatgccacctagcccaaaaagacatcggttatggatctgggtctacagccccagttgcatatatccagcttacctgttcttccag
ttgaacaatacactccaacagcgacataaaatcaccaccaggaagatactccatcaccaaaaagaggttacgcctatcggcaataaataaataccatcaa
tataagtcgttggcaaggaagctacttacgacaacatgcttacttagtttggaacgtccaaaacagcttcacaacgaatgggctcacaacattggcgagg
atatttctctccgtctcaatctgctcaatctgtggaggcacacatgctcagtacagccattgctacgaatgcgaataaaccatccctgtacctgtttttt
gcgcagtaagtgctctttcgcaagcactttaatcgcatattgatcgcctgtcgtcttcttccgcgccagatacacctttccgaacgcccctttcgaaatc
ggtttgataatatggaaatcacgaatagaaacacgataggaaactggcttcaagctcgaccttcgtggcgcacgaagcccgtcaccactatcgatgactt
ccagtgatttagtgcgcttcagcggccgcgccacctcaataggagcctgttgaaccagcattaccttgtgagacgcacgcattttactcatcttggcatg
gatcaagttgcgtagctgggaacagtacttggcgccacgttcaacggcaaagctggacgtttccacctcctgttgccgtattctgtcaatgattttcact
agtcgtgcacaaagtgcgaaagaatccacactggttacatcacaagtcgacgcttggatcgccacgacacgcagtgcgtggtagatgtgcatttcttcct
ggtcaaatatggacgacatcatctccgttgcgagcgtggcgttaatcgactctgtaagtttcaccagcgagttgttaatgacgtctgcttccagctccac
cctcttggacatcacacaaaaattagtatggtcgtccaagtggttagcgtccactttcgtttcacagagtttacacacgaccacacccttgtttgtgcgt
cggaacgtcacagtcatgggcctcctactgaactgtaggctatccagtacatcttcgggcaacgtatcatccacagctcgtccgttcacagcctccaccg
acagccctttggtaagagtaactcctgacgggatatgcatagccaccgtggcccaagcctctgtttggacgctcttaatcacgaccttgttctttactgc
atcgaacacgaactccagtccgaggaaaccatctccaaaggtcatatcgaaggtctccgtcttctgaacattctcaaacaaatctccaccgtcttccaaa
ctgggtccgtcctggtctgtgtcttgattttcgtcatccgacgccaagtgacgccatttcacttgattcttctcccaacgggtcagaacgtcctccaaag
cgtcgggaggggcgtccagcagtcctggccgcgtgatggaggctacaccggcactgaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagttcttcgtgcagacgctccagttcgctgctgctggtgct
actgttgctcgggcggcggccgttgcggtccgaggggagctcaagctccgccacgcgggccagggagagctgttggggccgcttggccat