Description :
From Genome Similarity Track
Location :
contig_38:409530- 415290
Transcript NameFunction/comments
g7143.t1hypothetical protein PHYSODRAFT_467769
g7144.t1conserved hypothetical protein

Sequence
5760 bases(100 bases per row)
TCGTGAGTGGGTCCGAGCACCAACACGTCTTCTCGGCGGTCCTCGAGCGCCATGAGCTCCGGGCCGCGGCTCTGCCAGCGCCCCGACTGCTTCCATAGCT
CGTGAGCGTTAGCACAGCCAGGTCCACGCGGTTGCCACCAATTTTGTGCATCTCGTCATCGATGAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGC
GGCAGCAGCGCGAAGAGGCCGTGGCCGCTTTTGCGCACGAAGCCGCCGCGCACCAGCAGCTGGTGGCTGAGAACCGCTGCGTCTGACGGCGCCTCCTTCT
CCGTGGGCGCCCACAACACAGAACGCAAGGCGCAGGGGGCGGCGCGTACCGCCTGGGACGACGACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCG
AGCAGCCCACATGAGCAGCGATTTGAGCCGCAAAAAAGGCAAGTATCTCTGGTGTGTGGCGTACACCACATTATTTTACGACATGGCTTCGTTTTTCTCT
GCAATGGACTCCCTTCAACAAGTAAAAAATTGGCATGGGATACTGTCGGAAGCCCCGCAAGATGATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTC
GGTCGAGTTCGTCTTGTTCGCTGCAAATGCTGGGCTGACTCATCAGCTGGGGAGAATAGTTGTTGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTG
GCCAACCCCGCAGTCGCCTATTCGTGTTCCGTCACTTGTCGTCGCCACGTCCGTTTGCACGCAGTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGC
ACGGTTTCAGGGCGTTATTGCCAACAAGTCCATTGCCGAGGACAGGTTGCACTCAGGATAGGTACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCA
ACGCATCCAAAGTCCAACGCAAGAGAAAAAGTGTAGGCTGGATATTGTGGTCCGTAATATCATGTGCATCTCCGCATACACCGCCACATCCGACCCCGTC
TCCGTCCCATAATACCCTATGCCAATTAAACCGGCTGGCGACCTTGACGTTGTCCGAAAAATACAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCC
TCGATCGATGGCTTCAGCTTGGCGCCAGCATCCGCACGATCCGTGGGACCTGCCGTCGCCGCCGCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAG
CGCTCACACTTTTCACGCCGCAGCACGCGCGCCCAGAGCCAAGCGAGAGCCCAAGCGCAGCAGGCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCG
ACCGACGAGCGCCGCAGCCTCCTGGCCGCCATGTTCGGTGGTCGCAGCAAGTCACGCACGTCGCGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAGC
GAGAAAAGGCCTTCCGCCTCGTGCGCCACGGCTCGGACCCGCTGCTGAACGACGCGTTCTACGCCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGGG
CTGGCTCACCAAGCAGGGCCACATGTGGAAGAGCTGGAAGACGCGCTTTTTTGTGCTCTTCTCGGACGGAACGTTCGCCTACTACAAGAACAAGGGCCGC
AAGAAAATCAAGGGCTGCATGCAGCTCAATGACGGCGTCGTGTCCGTGCAACACGTGGACGTCCGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAGA
AGGGGTTTTACAAGCTGCTGTGTTATTGCTGCAGCCAGTTTGAGGCCGAGCTGTGGGTCGCAGCGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTTA
CGAGACGGATCTAACGGCCACTGAGGAGAAGGCGGGCTCCAACGCGGTCACGAGACACTTGAACAAGATTTTCATCACAGATAAGCAGATCGCCAAGAGT
TTGGTGCAGTTCAAGGTGAACGAGCACGACCATTCGTACGCAGCAATTCACAATTTTATTGTCGAGCTGGACGACGCGATCATTGATGGTCATCATTTGG
AGCTCTATCAGGACCCAGAGATTGAGCTGCTGCCTGGTAATGACCTGGTACGGCTGATTCGTCGACATGTGGAAGATCGAGTGTTTATTCCGTTGTATGC
GGAGGCGTACGCGAGCTTGGAGACGGACAAGGTCAAGACGAGGCGCAGCAACCTCGAGCAGAACCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTTT
GGCATCTCGAAGGATTTATCCGTTTGCGACTGGAAGCTAGCCATCAATGTGATTAACATGCTCGAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTCA
TTTTATCAGCTGGAAAGGCCATCACGGAGTCTATTGCTCAATATAACGGCGACCTGTTCGAGGTATCAGATGAGACGCTGACGGCGGTTTTTCGGTACGT
AGTTACAATGCGTCACTGAGCGATTTACCGATTCTGCGAGCGCTTCTCAAGTACGGATACCAGCACCACCCAGCGTGTCAGAACAAAGCAAACGTCGTTT
CAGCTTTCCTCGATGGGATCAAATGGGTGGAGTGCTTCGAGACTGGCGATGAAAGCTATCAGTTTGATTCCTTAGCGCTAGCAGGGTCTCGCGTGTCGGT
ATCCATCTCGACTAACGATGTCGGCATTCAGTTTACGACCGATGGCAATGGTAGAGGGGCTATTGTTTACAGTGTGCGAAAGCAATCACAAGCAGCACTT
AGCGCTTCAATCGTCCCTGGATTGTCGCTGATTGCCATCAACCACGAACCAGTTATCGGGATGCCTTTCGACAAGATTATCCAGCGCGTGCGAACTGCGG
CACTCCCTAAGCAACTCATTTTCATGACCGAGTTTTACTACTACCAGCTTCTTTCGCTGGATTCGGAGATGTTTCGATACCTAATGTGTATTGCAGCGCG
CCGTGGGGACTTGGATTCGGCTGCTTGGCTGCGGTCGTCCACGGTGGAGCTCAATAAACTTTGCTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTGGA
TTCATCCCTGTATCTGGGAAGGGATCCCCACTTCACGCGGCAGTGCATAACGGTCAACTCTCTATGGTGAAGTATCTTATCTCAAGAGGGGCTGATACGA
ACTTGTGCAATCAGAAAGGAAGACGCCCACTTCATGTCGTGAAGCAGTCGATTGATATGGCGTTGATCATTGAGAGCCTTATTGATGCGGGAGCTGACAT
TGACGTAGCGGAAAAACACGGTCTTACCCCGCTAATGTTCATGTGCTTTAGAGCATCGCTTGAAGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATGTT
CGCCGTGTTGCATGGTCGAATGGATTTTCGGCTCTGGAGTTTGCAGTGAAGAGTGAACGAACAGAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAATC
CAAATATGCCTACGCTGGACGGAAACACAAGTTTGCATATGGCAGCCGCTCTCCCCCACGCTGATATAATCCTCCGGCTCCTACAGAGCGGTGCAAACCC
CAATGTTCAGAATCGGTATGGTCAGACTCCGGCCACAGTCCTACTTGCGTCTGCTCCTGGTGGAGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTTTA
ACATGTGCCGGTTGCGGTTGGACAAACGTGATCTCTTTGGTCGCCAGGCTTCTCACCTGGCAAACATCTCGCGAGATTCTCATGTCATGGGTCTACTTCG
AAAGTTGGGATCGCTGAACCGAGCAGGCAATAGCGTTGATGTCGATATCTTCGGTTGCTCATCTGTTGATTATAGTCATGGGATCGAGGTAAGCAAGGCG
ACAGAATATTTTGGATCGCAAATGCCGAACAATTCGTGGGAAATCATGACAAGACCGACCACGTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGGATTT
GATTCGCAAGTTAGTTGCAGGCACGGAAGTGGACTTGGTGGATGTGGTGGCGTTCGTGCTCTTCTTGGACAGCTTCTCGAGTCTTAACGAATTGGTGGAT
CGGTTGAGCGAGCATGTCCGAAACGGGATTAAAAGTAAGTTTTGTGCGTGCTTGTTTGTTAATCCTTCGCGCGGTCAATATGCACCTACATTAGACACTA
ACGTGGCATTTACCCATTTGTATTGTTCGTATAGGCCACGGACTTATCCGTCTCTTCATCATGATCCTGCTTTTTAGAAATACGGAAACGAAGGAAGTAG
ATGATCTGTCTGATCGCTTCTACAGCCTGATCAGTCACAACATTGACGTCCCTAGGGAAAAGTTGGTACCTCTTGTTGATGAGTATACCTCCCTTTATAG
GGAATATTTCTCATTGCGAGGAGCTGGAAACTACGCCACAAATTACGAAAGGATTCCAGAAATGATGACTAAGATATACGGCTTGGAGTCAGGCATTGAG
TTCGTATCCAACGAGCCCTTTCCGCTTCATTTGCACCGGTAAGTCGAGTGATAGCTCATTGTCTCCCTTTTGATCGAACATATCTGACCTATGGATTTCG
GTCCTCTTTCGTTGGGTAATATCTCAGGTATATTGATGCAGAACGGTGGGCTGAACAGTGCACGCTTCTGACGCACGCAGTCTTTTGCCAGATTCCAGGT
GGGATGTTATCGTCTGCTTGTTTAGTTGGAGGGTTGACTAAACTTTGCTGTCTCTAAAATGCAGTCCAAGATTTGATTTTGACAGGCTCGAAAAAGCAGC
ACTCCGTTGAATTTACGAGTATCAAACGATGGTTTCAGCACGTACGTTCTGTTGTCGCTTTATATTTACGTGCTAAAGAGATTAACTTTCGGGCGTTTTT
GTCGTGGCAATATTGTGTAGATCTCTGCGTACGTGATCAACGCTGTTCTTGTACAAAACTCCCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTATCTCAA
GGTAAAAGGATATTTCGGCTCGTTTGACCTCTGGTGGGCTGCATGCTAACCTTTGATTTCGAACTATGATCAGGCCGCCGATTATTGCGTGTCATTACAC
AATCATGATACGCTGGCTTCGATCTTATACGCATTGCAATCTACTGCGGTACAACGGCTTAGAAAGTCGATCGATTGTGTACGTTATTACCAGCTATGTT
CCTCTCGTGGGCACGAAGTCACGAATTCTGATTTGGTGGTGCATTACAGCTAAGTGCGGAAGCGAAGAAGATGATGAACGAAATGCAGCTACTTTCCGAC
AAAGGATGTCGCGAGATGAACCGGTTGATGCGCAAAACTGTCAACCCCAGTATGCCTTATATTGGGTTGTATCTCCAGGTAAAGACGCGCATTTCAAAGT
GATGCCTTCGGACGAAAATGTCTGACATTGTGCGTGTTGATTTAGGGCTTCCGTCGGACTGAACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGTCAAT
GCGAGTCGGCTACGAAAAATGGGCGAGTTGGCAATGGAAATCTTGCACCGCCAGTCTGTTGCGTACACTCTTCAAAACGACGAGAGTATTGATGTGAGTA
GCAATTTTGCCTGTCGTCGTAATCCTCAGCTGTGGATATCACGTCTAACCTGCGAATGTAACTCTTTTGCAGAAACTGTTGCACGTTTCAATGCCGTATT
CGTCGGAGGAGAGTCGATATGCTCGGTCATTGGAGGTCGAGCCGCGTGAAGCAGATGCGATTCCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTGATGA
CGACCTCGACCTTGAAAATGAAGTTCGCGAGTCAGTTGGCGGCGATGGAACCTTTGGATT