Description :
From Genome Similarity Track
Location :
Scaffold_25:409530- 410767
Sequence
1237 bases(100 bases per row)
CGTTGCAGCTGCCGCAATTGGCACTCGAGTGACCTGGCAACTAGCAGGTAAAACAGGGAACGCGTTGGAAGTGCCGAAAATGTTGAAGGAAGATCTCCGT
GCCGGAGGTAGCTATATAAGTTACCAGCTTGAAATGTTCGAGACATGACACCGTGTCGAAAGTCGCCACGAAAAAGTTGATATCATACACCTCCGAGCCG
TGTGAGCACCCGCGAGACACGGGTGTGACCGCACATGACACACTGGACGCCAAAATAGCTTGAACTGTGCTTTCCGCAACTCCATTGACTAAAACCCGGG
CTTGATATTGTAATTGGTGTCGACCAGCTGACGTAGCTGGTAGCGATGGAGCAGTAATGTCGTCGCGCTCCATAGAAGCCGGACAAAAAGAGCTGAAGAC
GCTTACCCCGAAAGCGAAGACAGAGTCGTCTTCGCAGGCCAGCTCGCATCAGCCACATGATCCGGCATAATGAATGTCAGTCGTCTCGTGTCGGCGTCTT
AGCTGGTCCTCTTCGCACCCTTGACCAGTTCATGACATCGGACTCTGTCTGCCCCGCACTGCGTTCCAAGAGCTGGATTAGCAACGTTTTCTCAGCGATG
TACTGAGGCATGTGCACGTACGGAGGTACAATAGCAATCACTTGCCCTTCCAAGTACGCTTCGAAAAAATCAAGTATCACAACTCGCGTAGTGCGCGGGT
GCGTGCAGACCTAAAACCCAGGCGGAGACTGGAGCATGATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN