Description :
From Genome Similarity Track
Location :
scaffold_897:4094- 5501
Transcript NameFunction/comments
Pl_101942Amino Acid/Auxin Permease (AAAP) Family

Sequence
1407 bases(100 bases per row)
TCGTAGCCCGACGGACAGTAGGGGAATGTCTTGTCGCTAACGATGTCGAGGAACAGGTTCTTACCTGTCGTGTACGTTACGTACCCACCAAGGCCAGCGC
AGACGACGATGATAAATGAACCGATGGCCTTCTCGTACCAAGGAGTGCGGTTCCAGAACACCTTGAGGTAGAAGAAGATTGGTAGGATGATGCAAGCCAT
CGACACAGCCCAAGCACCGACGAAATCCGTAAAGTCGACGAAGTGGTCCTTGAAAATGATGGAGATGATGAGGAGAGTCACGACGATGACAATGCGGAGC
GTAATGTACTTGGCGGTGACAAGAGGTCCGCTGTTGTGGTACTCGTCGATCAGAGCCTCTGGGGACAGATCGTACTCGGCGTCAGCCAGCGACGTGACAG
ATGGGCCCACCACAGAGGCACGGTCCTTAGGTTGCGAAGGTGTGTTGATCACTTCGAACGCCGGGGACTCTTCATCAGCAATAGGAAGGTTTGGACGTTT
GTGCATGCCCAGAATGCCGCGCTCAGCAATGTACAGCACGGGATTCAGGATCACGGACATAGCGATGGTGATGTGCAGTTGCATGAACATGTATGCAAGC
ACAACAGCACCGCGGTTGGCATTCAAGTCGAGCGCCGTGCCACCGATAGCGAAGAGGAGGTTTCCCGGAATCTGACACCCAACGAAAGAGTACGACGTCG
CACCGATGATGAGGAAGAGGCAAGCCGTGAAGATCATGGTCGTAGCAACAACACGGGGCATGCGCTCAGGCTGTGAGTGCTCACGCTGCAGAGCAGGCAC
CAGTACAGCGGCTGAGTAGGCCAATGCCAGGTTACCGAACGAACTCGCGGCCTGGCCAAAGTCGAAGTCGGGGGTAATCACGGACGGGTGGTCCGAACCG
ATGCCGTTCACCAGCACACCGAGAGCGATGGCATCAGCAAGAAGCGTGCCGAGGCAACCAGCAAAGGCAGCAGCAGCACCCTCCTTGAGAGTTGGAGTAA
GAATCACAGGCAACAGCATCGCAGCCATGATAATACTCCAGTATTGTTGGTCGAATGCATCAGGGGAGATACCATCAAGCAGGATTCCACCAAGCACCAG
GAATGCGGTCGGCACCAAGCAGCATACGCCGAACTGGACGAAGAGCACGAGGTAGCGACCAATCGGACCGCAGCACCACTCACCGACGTCACCGTAGGTC
TTGACAGTCTTGGGGGCTGCTAGCATGACGCGCGAAATAGCCACGCACGAGCAAATGTTGGCGAAACCCATGAAGACCAGCGCGATTGTGGTGATGACGG
CACCCGAACGAGCAAAGTTAGACGGGAGACCCAGCGTACCGATGCCATACACGGTACAAAAGAAGTTGAAAGAAATCTTGAGGTCCTCAGTAGTGAAATA
CGCCATT