Description :
From Genome Similarity Track
Location :
Scaffold_16:409308- 413407
Transcript NameFunction/comments
Physo_309436Hypothetical protein
Physo_416835ankyrin repeat
Physo_535649cytochrome P450 family protein

Sequence
4099 bases(100 bases per row)
CTCGTGGATCTGCGGCTGGATGTACCCAATGGATGGGACTTTAGTGAAGAACGAGAGGATAAGCTCAAGGCCCACAACGGCAAGTACCTACCCGTGGTGA
AGGAAAAGCTTCCAATCCGGTCAAAGGCTGCAATGCTTAGCGTATTTTCCGGCGCGTTGAGTTCCTCGGGTAATAGCGTGGCAGTTGGGCACCTGGACCC
GCACGCTTTGGAATTAATATTTGGCTTCGCTGCGACAGCAGCGAGACGATCGGTTACGATACTCAGAGACTCGGATAGGTTCTCGTCTGTAGTGATGGAC
GGCTAAAAGCAGATCTTGCTTCTTGTATTGCTACCCGTCAAAGAAACTTCGGACCGATCTTTGCCCAAGTATTTTTTTTACGGATGGAGATTTTGTGAGT
TCATTGATTTCATTAATTTGGTCCTAGCAGCTCATCGGAGCCAATCTGCTACAGCATGGACATAGTGTTGCGTAGAGCGCAGAGAGATGACCACGAACGC
AGCTCTCGCCCACTCAGCGAAATTTGGGATTGCGGGATCTCTGCGCCCAAGCACAGAGTCCGTTAGATATGGGCTACAGATTGCAATACAAAACTCAAGT
AAGCTACAACGCAAAGCACGCCTACTTCAATCGGGGACAAGTAGAGCAGCCAACACGACAAACCCCACGTGTCGTTGCTCAATACTTCACACATAGTTTA
CTAGGCCGCGAGCGCCCCTGCACCTTCTTGACTGGTAACTCGACCTGCAAGTTCCTCCAGCCATTGTATCACGTAAATGCACTCCGCCGAAGAACCATAT
TTCCGAATGAATTTTGGTGTGGCTGCAATAACCCCGGGGGTGATCAAGTGAGGGTAGTGCGCGTACTGGAAGAGCAGCATCTCGAACTTGTCGCAGTTGT
GCATGCGGACGCCATTCATACCGGCTGGAACGCACGCAGGGAATTCGTCATGGAGCCAGGACGCAATACGCAGCGGACCATTCAGCGTAGCATCCTGGAC
CATCTCGACAGTACACGTAAATCCGCCTGGTAGGTTTTTGTGTAGCCACTTCATCACATCTAAGCGCTTAAACGCTGCTGCCAAGCGCATTGTTTCCTGT
CCACAACCCTCCAATCCATGGGCGTGCAGCCACTGCACCACCTCTAGATGTCCGTTAATTGCAGCATTGTGCAATGCGTTCTTGGTACGCCCTTCACTTG
TACCGGTATTTTCGAACAGCCATTGTACAACTTCAAGGTGGCCACCACCAGCAGCATTGCCCAACGCATCCGTTCCGCAAACACTGCCAACATGATTTTC
CAGTAGCCACTTGACTACTTCGAGGTGTCCTCCTCCTGCTGCAGAGGATATCGGGTCGCCAGTATGGGGCCACCATGCACCTTGGTGGCGTATCACGTTG
ACTGGACGGAAGTCAAGGAGGAACTTCAAAACCTCCAGTTGCCCAGATCCTGCGGCGACATCCACGGGGAAAAAGCCTGGGGGCTGGTGGGCATGCAAAA
GTGCCTTAATCATGACTTCGACACATTTGATGTGGCCATTACAGATCGCACTTCGGAGTGGAGCCTAGTACGAGCGCGCGGTTGATCTTGATCGTGGCCT
TCTGCTGACACAGATACTCCACTACTCTCCACTGACCGGCTCCAGCAGCCAGCACGAAAGGGTTACGGCCATATCGGAGCGTCTTACTGAGCTGCCACGG
GCTGATCTCGATCGGGTATTCCATAAGCCACTCGACAGCAGCCAGATCGCCGCACTCGCTTGCCTTCCCTATCGCGTCGTACCAGTGATTCGACGTAAAG
ACACCGGAGTGGAATTCCGGAAGAGGCGAGTGTAAGAGCGCAATCTGCTGCATTAAATCCAATCGCCCACTGCCAGCCAAGTCTCGTATCGCAGATGTAG
CCGAGTCGGCGTCGCAGCGTAGATATCCGCACTCCAACATCCACTCGATCACGTCAACTCGCGGACAATTGGCAGCATAATCCAGAACACATCGACCCGG
AGGCAGCAAGAGTTGGACGAGCTCGTCGTCGCCTGCGCCGAGAGCGAGTTGGATCGCTCGGTCGTAGTTAGAGCCAAATTTGTCGTGGGGAATAGTCTCG
CAGAGCCATCTCACGACGTGGAAATGCCCATTGGTAACAGCAACCAGCATGACGCCATCTCCCCACAGATCTTCAGTGCCACCTCCATTACGCTCGAACC
GACCAGAACATGCACCATCCGAAGCAAAAACCTTTCGTCTTTTCGCGTCGTTGCCCGAACGACGATGCTCCCACAGAAACTTCAGTATGTGGAGATGTCC
CTTGCTAGCTGCCGCGCTAGCTACATCATAGGGCGCTTCACAGTCGGGAAAATGTGCAAAAAAACACTTCACGACTGCCAAGTCACCTCGATCCGCAGCA
ACTTCTAGCCCCTTCGAGAACTGGAAGCGGTAGTAGTGGGGGTCCGACCGCAGGTAATTCGTCAGAGTCCATTGGGGCGTTCTGGTCTCGACTGAGGTGC
AGCTTGACGCCCATATCCAGTCTAGCAGCTTGGTGGAGCCAAGCGCGCACGCCTCACTGAGCGACAGGTTCGGCGATGGTCCAAGAAAACTCGAGATAGC
CCAAGTGCTGCATTCGACGTCTCGAAACGCTGGGTACGGGCGTAACAGCATTTCGATGCAGACAAGCATACTCCCAACTTTCTGATCGTTCGACGCAGAA
TCAATTGTGTGGAGAACAAGGGCAATACGATCAATCAATTAAAAAAATGATCTTTTATCCGGAAAAACTGTTTTTTTCATCCAGAATTCACATCATTGCG
TTGTAGTATCCTTGCAAGACATGAAGGCGGCCATTTCCAGCGTACTAGTACTGGATTGTTCTGGTCGGGCAGCTCTCCGATTGGTTAGTAGAGCGCCATT
GGCAACGTCGAGGTGTCCATTTGCAGAATCGCATTAGCCGTACGTCTGTCCATTAGCCGTGGCTTCATCCAACGGGTATGAACACAGCCACTTGGATCCT
CGTAAATGACGGTTTAACGCCGCTAGCCATCTAGCTGATATCGTCTGAATTGCATACAAGGTTGAGTCTCAGCTTGACGCTCTTATAAAAATCCGCGACT
CAAACCTGAAGTATGTATACCTCTCCCTTCCAACACGACTTTAGTCGAAACCTTCAAATGGTTCGTGTGAACGAGCAAGCTATAAGCTGGAAATTAATAC
ATGCATTGGAACCCCTTAAAGCAAAAGCAATTAGCAGGTTAGAGAGGAGCTCAGCATCTTAGTCGCAGTTCAAACCTTTTCACGGGCTTCTGTTCGCTAT
GGCGCTGGGATAGTTTTCGTCGAGCCAACTCCGAATGATTTCGGCCGTTTGCGTTTTTTTGGGAAAAGGGGATCTGAAAAATCGCCCCGAAGTTCTTTAA
GGAATTTTGGAGTGAAGATGCTCGGGTACGTGACTTGCAGAAACAGTAACATCTCCAACGCTTTCTCGTCATACCAGACGATAAGCTGCTTATGAGAGGT
CACAGCGGAGCGGCTCAGAATGTAACCCAGACTGCACGTCACCGCTCGCAGTACAACGGCACCCTGGCACTTGATCCACTTTATGGGCGCTGGTTCGGAC
TTCATACTGTCCTACCTCCACCTCAGCATGGCCTCGGCTAACCTGAGCAGCGCGGTGTACGGCACTACCACACCAACATGGACAATCACATGTGCATGGA
GACAGTAGGCGACCCGCATTACGCGTCCCACGGAACATGGCTCAGTGGGGATGCGTCTGGCCACCGATGTTGTCGTGCTCTTCTTCATCACGTCCGGCCT
TGTGATGAAGGAGGACATTGCCGGTTTCGAGGAAAACATCGCGGCCAAGAACGAGCTTATGTGCTGATTGGCAGTATCCCCATGGGGCCTTCCCATGCGA
GAACGCAGCGGATAACTATAGTTTTGCGTAAGAAGTGGATAACAATAGTTTGATTGAGTAGTTTGCGATGTACACGATAGATATGCCCTTCTTAAACTAA
GCAAAATATATTTTCTCCGGGTTATTCTCAGGTTAGTGAAAACATGCGCTCATTTTCACAAAGAAATAGTTCCGGGTAAAAGTTCCGGTCAGGGTGAAA