Description :
From Genome Similarity Track
Location :
Scaffold_205:4093- 5983
Transcript NameFunction/comments
Hyaar_Emoy2812560hypothetical protein

Sequence
1890 bases(100 bases per row)
CTTGGCGCACTACTTCACTTCTTATGAGCTCAGGTTGAATACATCACCTATTAAATACTCCTTCAGGTTGAAGATCCAGCGTTCTTCATCTTGGGATTCA
CGAATACGCTTGATTCTGACCCTCTGCACCAATTTTGCTGTTATATATCAAGCGGATGACGTCATTTCTGCACCGATATCGTAATTAAGTAATTCTTGCG
ATCAGATCGGCTTGTCTTGGTTTTGGTAATTTATCCAAACGATTCAGAGTAACCAGATTTTGGCGATCTTCTTTTGCTGTGATGAGAGTCCCTTTCTCCC
TTTGTAACGTAGAACTGGATAGCCGATCTGCACTTTTGGTTGCAATATCGATTCATATAAAAGTGCTCATAGATCGTCCAGGATCGCAAAATTCTATTAC
GCCCTGTATCTCAAAAGTTAAAGGCCTAGTGCTTTGCAGTCGATCTCACCTCGCATCTGCCGGATCAACAAGTTGGAGTCACCGCATATAATAACCCGCC
CCCGGTCCAGATTGGCAAGTAAGTCAAAGAATAACAGCAGGTCATTATATTCGGCTTTGTTTACCGTCAGATTGGTCATGTACCTGGATTCCACTAAAAT
AACGTCCATTTTGGAAGTTTCCATGTTACTGCGCTATATGAGCCTCTTTTTTTCTTGATCCTTGAGGATTCTTTGAAAACTGGCTACTATCAGACTCTCG
TCCACCTCTACTGTCGGTGGGGCACGATCATCTTATGCCGGCACTCCTTTCGTGGAGCTATCGCGATCAACATCTCTTTAATCTCCTAACGTGGGAATAT
ACTTGCTGCCAATGATCCCAAGATCTCATCGTCTCCTTTATCACATTTCTTCATTTCTATATGCCAGTTCGACAACAGAGAATCCCAACGCCCTAATCTC
CCATTGGGACCTCAATATCGCATCGACCGTGCCAATGTAGAATGTCGTGTCAGCATAGCGATTTCTCTTGAGACCATACTAGTGTAATACACGTCCAGGA
TGCGAAGCAGCTCCATAACCGCCTTCTCCACCTTCCCATAGTTGATTTCGTTTGTCTTTAGCGTTCGACTGGTGAAAGAATCTGGCCGATACACTCCATC
GTATTCTTGGATCAGGGTCTCTGATACGGCCCACTTGCAGGCATATACCACGATCACTGGAGGGAGTTCTGGTTCTAAATGTCTCAGCGTCGGGGTTGAA
GATCTTTGCCTTCAGCATAGTGAATGCCATTGTAGCCTCATTCCATCGGTTTCTCTGTTTCGTCTTCAGATCGCTCGTCTTTATCCATACGCTGGAAATC
CGCTTCTGACGATACATGCAGCACAGCCGCATAGATCGCGTCGTCCTCGATGAAACGGCTGTATAAGGGTCAGAATTTCGAGAAAGAATTACATAAGTCT
CAACGCGCTCGGAAACGGTATGCTGACCAACCATTCCAAGTCCTGTGGGTGCGCTTCGAGACCTGATGTTATAAATAATCGACTTTGCGACAACACCAAA
AATTCTTTGTAAGAATGATCGACAAGTTCCACTCATTTCAAGCTTCCAGAAATCTCTTCAAGTTTACTATATAGAATACCAAGTCCTTGCCGGTATAAGG
ATATCGTCGATGTACGGTCTCCTCCCAAGTATGGATGGTTGCAGATCTCTCTCCATTCCCCTTCTTTGAACACGTCGATCCAACCTTCCGAGGACGAATA
CTTGCTGACCTTGAGTAATACCTTACGTGCATTGTCAACTAGACATTGGTAGATTTGAGGTGCATTATTTAGCTTGAAGGGCATTTGAAGCCATTCGAAA
AGTCCGAATGGTATACGCTGAGATCAGCTTCACTCTCTCGGTCATTTCGACAAACAAAAATCCACTTGCCATGTCCAGCAAGAAGTATTA