Description :
From Genome Similarity Track
Location :
Scaffold_85:4093- 5489
Transcript NameFunction/comments
Hyaar_Emoy2808653putative amino acid transporter

Sequence
1396 bases(100 bases per row)
TACAACACGCGCAATAGCAGGACAAACGTTAGCTCCGCTTATCGACAATACCAACGATCGGAAAAAATTGCGCGCTAGTGACTATGGCGGAGTCGGGCTC
TTGCGGCTCTGCGATTTCCGGAACAAACGCCAGTGTGCTCGTCATGTCATCTGTGCGATTTTGCACAATGACGGAAATAAGGCACTAACAAGTCCCGCGG
TGGAGGCTGACGGTGAAATTCTGGACCGACTACGGCGACACATCGCCGCTTTAAGCTCGAGCGCCGACAACCTTCAAGCCTTCCGAGCATCCAATGAAGA
CAAGAGCTGGAGTGCGATTCATACGTTTCTAGCGAAGTCGCTAGCTCATGAGTCCATCGAACAGACTCACCGTGACTGAGAGCTCAGAGGGGAGCAATAG
GAACCGACCACCGCCATTGGCGGAGAGGTAGCGCGATACCTATGGAACACCTGACAGTGAAGCCACTATTTTCCAACCCTAAATCTCATCAATCTGGTCA
AGGCCGCCGGCAAGCTGCCACATTATACCACTCACAAAACGTTCGTGGCTTCAAGAAACAGGACGAGCATAAATGGATACGAGGGTGGAAGCAGCAAGGC
AAACGCCACAAGACTATATTCTGGGGTCTGCAAGAGACACACATTGATTTCTGAGCGAGTGTCTCTGCAGTATACTGACGCATGGCGGACCGTCTGGGGC
GTCCAGTTTGAGCAATCAGAGCGTCAGCACCCGTTGACGTCTTACCGGAGTCTGAGTAGCGACAACACTGGAAGCGTAGCGCTTTACTGGACACGACCAA
AGATCACGACAGTGTGCCATGGCACTCAGAACTCTGTACTGAACGGGTCCTTGCTGTCCTTGTCGAAGGGTTTTTGGTTGTCAACTTGTATGCGCCCAAC
GACAGACGGGAACGGGAACATTTCTTCAGCGACTGCGGCGCTGGCCGTGGCATAACACGGCCATGATACTATTCGTAGATTTCTATTGCGTACAAAGTCC
CCATCTAGACCTGTTGGGGGGTTCGCGGTCAGGCGGCTAGAAATCCCGGCATTGACAACGCTACTTCAAACTTTAGATCTTGAGGACGCTACAACTCTTA
TGGGTGCGGCAATGAAAGATGAGGTCACCAATCTAACTGACTATTACACTTTTTGGACTGCGCAATCAGCTAGTAGGATCTACCGTTTCAATACACCCAC
GACTTGGAATGCTGCTATTCAGCACGTTAAAGTGCGGCTACGGTCCTTCCCTCAGACCACCAAAAAATTACTTTACACGTGATGGACACCGGCTCGAGGA
GGTATCAGAGCCGATCGGCCCCGTCTGTGCGGTATTCTATCCACTCGGCGACACCAGAGCGCATCCACGAGGAACTCGAAAATGATCTCATAGGAT