Description :
From Genome Similarity Track
Location :
Scaffold_129:40929- 44541
Transcript NameFunction/comments
Hyaar_Emoy2810537trafficking protein particle complex subunit putativ
Hyaar_Emoy2810538tubulin gamma chain
Hyaar_Emoy2810539tubulin gamma2 chain putative

Sequence
3612 bases(100 bases per row)
GACATTGTTGATGCTTGCAAAAGTTACGAACTATCAGATGCGGCCTAGTATGTTTTACCGACTAATATTGCTGCAATTCGGACATTTACTCCGAATGCTT
TGACGTGGCGAAGACATAGTCTGGCGATGATTTTGTCGATAAAATGGCCATGATGACCTAACAGCGCCTTATACGAAATGCTTCGTCATCCTCATTTTGC
GTGGAAAACATGCTGTCTTTGTGTGGAGAAGCGGCGGAGATGTATGCCAGATTCTCCGAAACCCTATCTTAAACTTCATAGCTGAGCTGCATCACTAGAT
GAAAAAAGTGAGCTTGTCCTGGTAGTGAGAGGAAGTGGCGAGAGCAAGGCAAAATCACTTTTGCAGCACAGTTGTGAATGCGGCCAATGCCATTGTCGCC
GCTACGTCATGTAGAAATGCAGATCCTTTATCCAGACTCTGCTTGAATTCCCAAGCTAGACGGTCTGCACGGTAAGGCGGTCGTGAACAGTGTGCTTTTA
TACAGAATGTGGGTCCAATGAGGGCTCAATTCCACGCGTAAATGCGCCACAGACAACAACACTCCGTTTGTCATGCACTGGAAGCAAACGAAAAGTACTA
TACTGACGGGTAGAAATAGAGTTAGGAAAGGGTGCGCCAGGTCCGGTACTAAGGCTCCACCAAAGCGCGGGACTGGACGAGTGAGACACTTCGGTGTTAC
CAAACTAATTAAGTTCTTAAAAATGTAGAGCCGTTTTAGTGCGACCTTGGAACATCAAGGCTGGATTCGATGTCGCCCGCACCCCAGCAACTTACCTGTA
CTTTCCAGGCCGCGAGACGGTATTACATACATATGGATTCGACACAACGAGTAGCGCCTGAGGGCAACGAGGTCATCGTGGAAAGTGACACATATATTCG
GGGCGAACTCAGGCATACGCCGCGCTGTTGTGAGCCACGAACAACCACGGAATCAACTTTAGACAGCGATGTTGCGAACCTGGTTATCGGACTACTAGAC
ATTACTGCTGAAATTATTAACTACTCCCAGCTCTGCAAGTATGAAGTACTCAACCCGCCACTCGAAGTCAGTCAACAACTAGCTACCACGTTAGCTCCAC
ACAAATGAAGCCTAACACGTGTCGTGTACGGAAGATTTTTCGAAGCATTTTTTGATAGCCCGATGTCATGACTGACCAGACCGTGTTTAGCTCCAACTTC
ATCAAAACTTCTGTAGCATTTGCAAAATAAATCTGAAATGATAGTACACCTGCTAACTGGCAGCAGTCACTAAGTACGCCCAAAGTTCGCAGTCTTCAAG
ACGTACAAAACAGGCTGATGGAAGGTGGTCGCGGCGTCTCTACGACGAATCTGCACATTTTGGACCGGCCGCTAAGCCGTGGAAAGAGCGAAGTGAGTAT
AAAATACATCGTACACTAAATAGAAACAGGTTTTCGTCAAAACTTCCTTGTCACAAGGCAATGAGTCCATGGGTTTAACACCAGCTAAACCTTCTGAAAT
ATGGTAATTTATTTCGGACTCTTATTTAAATTACTTACACGTGGTTCTGCTTGTACAGGTAAGTCTCAGCGTCTTTTCCTTCCTCTTTTCCGAGATGGTC
CAGTATTTCCAAGGCCGCGTGCAAAATATCTCGGACCTCGAGAACCGGTGCGACTTTTACAACATTTATCAATGCAGACGGTCCTTTTTTTGATCCACTC
ACACGAAACACCTCAATTTTCAATGTGTATTTCTTGCTGTAATGTCTATCGTGCAGACTTGATATTGCTGGGTTTGGCGTGGGTGTCCGCGTCTTGGAGA
TCTTGGGTCATCGCGAAAAGTCTGGACGGCGTGAAATCCGGTTACTGGCCATGCTGCAGTTCATCGTGTCCAACTGCTGGAAAGCGCTGTTCGGCAAAGC
TGCCGATGCGCTGGAGCGCAGTACCGAAAACGAAAACGAGTACATGATACACGAGCTCGAGCCTCTGACGAACAAGTTCGTGTCGGTGCCACCTGACCTC
GGGCAGCTTGACTGCGCTGCGTACATCGCAGGCATCGTGCGTGGTATTCTATGCAGCAGCGGCTTCCTGGCAGATGTTACGGCGCACACAGTCGAAGTTC
CTGGTGGTCAGCGGAACAAAACGGTGTTCCTGGTCAAGTTTAATGAAAGTGTGATCCACCGCGAGCGTGTTTTGACGTAACTTGTTGCCGTGTGAGCAGC
GAGAAGGGAGTGATAAAATGGAGTTAAATAGACCACGCAGTCTTGCTAATTCAAAAGTTTGGCAGCATACGTGCTCACAAGGGAGCGAGCATGGTATGAT
GCACTACATACGCACGTCATCCGCGGTGCTAGTAGCAGTGTGCGGGGGTGGCTGTCCCCACGTCGCGTAGTCTGCGCGTTCACTAGCCTTGTACTCGTCT
ACCAGGTTCTGCACCACCTCGCGTGCGCTATCGAACTCGTCCAAATTCTCTGCAAACATAGGTTCCTTCCGGTAATTCTCGATGAAAGCCCCATGTTTTT
TCAGTCGATCGTATTGGAGCAGCAGCTTGTGAAAGAGTGCGCCAATGCTCGTGTGATTGGCCAGCATGAGGCCATTCACCTTGTGCGCCGTCTCCATGTA
CGGTGACTTGCGTGATAGCGCCACTTGGATCGATGCCGGTCCCCACGGAATAAACCGCACCAACTTCCTTTCACGGATGCGTTGCAATGACTTGTGCACT
TGCGTGGGATCCACATCGCCCTGGATGATGTTCAATATCGAGATGTAGCACCCCGTCTTTGTCGACGTGCTCACCATGATATTTTTCGGTTGCAGGAGAC
GTCTCATGACGTCCAGCACCGTCGTCTTCCTCACGGCAGACACCTGAGCGTCAATCGTCAGCGGGGTATAGCCCGTCATCAAGAAATGACAGCGTGGAGT
GGGAATCAACGATGCCACCAATCCAATCAGGTCATTGTTCATATAGCCAGGATACCGCAATGTTGTGGTACTGGCCGCCATGACCGTCGACACGAGCGAG
TTCAGCTGCGACACCGTGGGGTTCTCCACCCTCAATCGCTCCACTGCAATGCGGTTCAGCGCCGTGTTGTCCAGCACCACGACCGAGTCTGCGTTCAGCA
CCAACCTCTTCATTGTAAGCAGTGAATTGTACGGCTGGACCACCACATCGCTCTGGAAATCCGATTGATTCGGAAATACCGAGTACGTCTGGATCAGTTT
TTTCGGAAAGTGGTCGTTCAAGTTCTCCAGTAAGTACGAACCCATGCCTGAGCCTGTGCCTCCTGCAATCGAGTGGCACAAGACGAACCCTTCGAGACTG
TCGGATCCATCAGCTTCTCGATCAATCATCTCCATCAATTGGTCGTGGTGACTCTCTCCTTGGTGGTACCCGGACGCCCAATTGTTGCCGGCGCCTCCTC
CTTCTTTCGATACAAAAAAGTTCTCGGGATTGTATAAATTCTTAAAGGCAGAAGTACTGATACTGTTAATTACGCGCGGCTCGAGGTCCATTAAAAGAGC
GCGAGGGATGTAGTGCTCGTCATCCGCCTGGTAAAAGAACACGTCCTTGCGGTCATGACCTGACGTGGCAAAATCCTGCACGATCCCGTCTGCAGAGATT
CCGTGCTCCACG