Description :
From Genome Similarity Track
Location :
Scaffold_8:409101- 413874
Transcript NameFunction/comments
Physo_129584reverse transcriptase

Sequence
4773 bases(100 bases per row)
ACCTCGGTGTAGACACACCAAATGCTACATACATTTAGAATCACCACGATGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTT
TAGCCAATCAGCGACATGCACAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAAAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTA
AACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCAATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCGGAGTGGGAGGCCCTCCAACGACTGTCATCAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCAGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGTCGTCCGG
GACGACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGTAACTATGTCGGAAGAGAAGGCGAGCCTCTCCTCCGTTGGCTTGTCGATCTCGACACTGCC
ATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCCTATCTCTTCCGTGAGTACCCGAGTACTC
TCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGGCGAGGCCACAGCCACGCCCGGTAGTGAG
GACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCTGGACCCCAGTAGTCACAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTC
GGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGATATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGGCATC
AGTAGACGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGC
AAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAACGTGAACTCGATGAGAGCAAGCAGCTCACTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGA
ACTTTGTTCAACTGCGAAGTCTATCAAGGCTTAACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGACAACGGGTGCCGTCGTGAA
GACCGAGAAGCGCATAGTACGCGTGCGCTTCACGTATAAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTA
TTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGCAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCC
CTGTTGCCGCTACGCACGCATCGACAGGTACGCGCGACTCCCCCCTCGAGACAGCGCCTAATACCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACA
CGCCCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGATGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAG
TCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGA
GCCAAGGTGACGAAACGCCGTCGACTCCGGGAGTCGTTGGCTTGAGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTC
CGCCAATGGTTGGCGTCGAGGTATTGAAGTCGCATCGATTCCGGGAGTCGATAGCTTGGACGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCC
GTAATGGAGGGCTCCACCAATAACAGGCGTCGATGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGAAGGTTGCAAACGTCCCG
CACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCACGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGC
CGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGATCCGCAAAACAAGAAGACGGCGCATGCGA
AGATCGCTGCGCAAGTCTCGTCCCGGGGCCGAGACGCAACAAGAAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCT
TGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCATGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAA
GCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACCGAGGCAGTTC
TTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCATTGAAGACGAGCCCCT
ACTACGAGATCTTACGGGAGTACGCGGACGTACTCCTGGAAGAGATTCCTGCGGAGCTTCCGCAGGATAACGCATCCAGCACGAGATTGATCTCGTGCCG
GGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCTGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCACAAAGCTGGACAAGTGC
GGGAATCGAAATCCCCGCACAGTGCTCCGACGTTTTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGAC
GATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTAT
CAGATCCTCATGCGTGAGAGCGACATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACG
CCCCTGCGACCTTCAACAGGTGCGTAACGCGATTGTTGCGCTCGGTGCGCGACTTCACACCGAGCTACTTCGACGATGTGTTCGTCCACAGTCGGGCTGC
GGACGGGATGAGCAATGTTGAGATACACAAGGTGCATCACCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATC
TTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCTGACCATGAGAAGGTCAGAGTGATCAATGAGTGGTCGACGC
CGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACATACTTGTGCAAGTACGTGAAGGACTACGCAGGCATGATACACCCACTGTCACAGCT
CCTGAAGAAAGACGCCGAGTGGGTTTGGGCTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGTCAGCC
GACCAAGATCGTCCATTCGACGTTGTGTGTGACGCATCCGACTTTGCAATCGCATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCT
ACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTA
TCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCACCGCACATCTCGCAACGCATGGCGAGACGGCTC
TCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCTACGCGCTCTCGCGTCGACCTGACTACGCCACGACTC
AATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTCCGCGTCGTGCGCGTACGCGAAGCTCTTGCTGA
CCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGGGCTCGTGCACACCGTTCCCGGGTGCACGGCGGGTTATTACTCTA
CAGTGCAGTCGACGACAACGCGGAGCGCGTTGTCGTGCCCAATGACCATTACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTTCGGGA
CATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTT
GTCAACGTGTGAAGCATGCGCCTTTCGCGCAGGCTCCCTTGCAGTCATTACCAACTCCACGGGAGTGTTGGCA