Description :
From Genome Similarity Track
Location :
Scaffold_103:40910- 41921
Transcript NameFunction/comments
g13080.t1hypothetical protein

Sequence
1011 bases(100 bases per row)
GGAGCTTGGACACTGGCAGCTGGTACTACAACGGCAAGGCGTACCAGAAGTACGCGTCATTGTGTTTGATGGCCGCCGACAGCTCAGTGGTGGGAGATGA
CACTACACTCCTGAGTAGTTGTTTGTCGAAGCTGGAGACACTCATCGAACCTTTTGTCAGCAACACGCTGAGCGTCCCATTGGTGTACGAGACAACGTAC
AAGGGCATTGTGACAAGCCAGGTTTTCACTAACAATGATGTCAACGTAGAGTTTGGTAACGGAGTGTACAACGACCATCACTACCACTACGGCTACTGGA
TCACAGCGTCGGCCATCCTGAAAAAGCTGGATCCGACATGGTCAGGCATGGCTCAACTCGAGACGATGGTGTGGACGCTGCTCCGCGATGTGGCCAACCC
GAGCTCGGAGGACACACACTTCCCCAAGTTCCGCCACTTCTCCTGGTTTCTGGGTCACTCCTACTCGCACGGCGTGACCCCCATGGCTGATGGTAAGGAT
GAAGAGAGCACGTCGGAGGATGTGAACTTCTACTACGGTATGATGCTGTGGGGCAAGGCGGCGGGGAACAAGGCGGTGGAGGACCTGGGGAGCCTCATGC
TGCGCCTCAACGCGCGTACAGTGCGCACCTACTTCCTCATGACGTCGGACAACACGATTCACCCGCCTCAGTTCGTGCCCAACCACGTCACGGGCATCTT
CTTCGACAATAAGGCGGACTACGCGACGTGGTTCAGTGCCGAGAAGCACTGTATCCACGGCATCCAGATGATCCCTGTGTCACCGATCAACGGTCTGGTG
CGCACGACTGCATTCATTCAGGAGGAATGGGATGACATCCTGTCGAAGGAGGCGATTGTCACGGGTGACAACACTAGCAATGCGTGGTTGTCACTCCTCC
TTGTTAACGAAGCGGCGATTAATCAGGCAGATGCGCTGTCAAGGCTCACGACAGCGACCATGGACGACGGTCTCACCCGTTCGTGGGCCTTGTACAATGC
CGCGTCTCAGC