Description :
From Genome Similarity Track
Location :
Scaffold_705:4091- 6853
Sequence
2762 bases(100 bases per row)
AGcGGACGAGGGGAGCGGAGGgAGGGGACAAGAGCAGGgAGCGGAGGGgACGGAACCGCGTCCGATGACGCGCTGCGACGCTAAAAGCAGCCAaCAAATG
GAGcTCCCCATGGAGTGTCTGAgTAAAGGGGTCTgCATGACGGCGCTTGGAGTGGGTTCGGTGGGGACGAGaGgAGGGGgCGGAGCGTCCGCTGtGGTGC
TATGCGCGTTCTGGTGCTTGAGGGAGTAGCGACAGAGCCGTGTCGAGAATGGCCAGCCAATGGGTGAGCCGCCAGCGGCGTGCGCCGGCGAGGGAATGGA
CGTCTCTGGGGCACGAGACAAGGCCCGAtGGTAAGTCTGGCAATGGTTGCGCGCAAGGGtGGACGAATGCACAATGAGGAACACCATGGGGTCTCaGgTG
aTCTCAAATGGCACGTGAAAGTCACGTGGACCAGATCAAACTGCCACGCTCCCTACATGCTCGTCAAGAGTAGAAGTGCAGTTGACATGAAGCGAATGCA
ATCTCATGCAAACGTCGAACGTGCCGACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAG
GTTACCCGTCACACATTTGCCGCCGGCTTCATTCGTTGGGCTTGTCGAGTTCGATGCAGCTGGAGTGGGCGAATGTGGTGGGATCGATGTCGGTGTTGAG
GTTTTCGGAGCCGTCGTGGCTTTCGTAGGACGAGGTCGGGCTGCTGGTGTGGTCGAAGAAATGGGCGCAGATGTCTCCTCCGCTCCTGTTTCTGATGGGC
TCgggggtttAGTAGAAGGAGTGAGAGTCTTGACACCACAGCGCTCACCTGAGACGATGATCACTTCGAGAAGAGAGTGGATGGGTCTTCATGCTGGCAA
GTTGGAGACTGATCGAGTCAAGCACTGATaTtAATAAGAATTGATCTCGTTGAGAGCCTGGGCCTTCGTGGCtCcGACTGATTAGTCATTCTAATGAACT
GTTGACTGACATCcGTCAGTTGCTGTCTTCTGGGAACGGCTTATACATCGACTCTCTACGATTTGGTATTgCTCTTGCCGTCAGTGAATGGAGCCAGCTG
ACAATTGCCCAGCAGACACTTCCCAGGAAGAGTCTTTTTGGAGCCTTTGTAGAGGAGGGCACGAGGTCATATCAAGGAAGTCGTTTTGTCCCTTGAGATT
ACTACTGTACTACAATGTACGTAGTGTAGAGCAGCACAGCCCCGCTAGCCGAATGAGAACTCGTTGCCATCAAGAAGATACTACGTAGTACTACGTAGTA
CGTTGTATCGTGCAAAATTTTTCAGAAATGGTCTTCATTTTCCGGGTGGAGGTAGTAGAAGACTCGAAGAGTTTCTCCGAGTATGGCAGCGCGAAGTGAC
TTCGAGTGACCCAACTATGAATTCCAGGAAGATTGGActGTGTAACGCGAAGCCTTCTTATG