Description :
From Genome Similarity Track
Location :
Scaffold_50:40908- 42602
Transcript NameFunction/comments
Phyke_g2488hypothetical protein

Sequence
1694 bases(100 bases per row)
ACACAGGACGACTCATGGAGGGCGAAGCTTCAGCTGGATGGGACGTTCGCCAGGACGAGGCTACTGGACAGGTTTACTATTGGAACGCAATCACAGGAGA
GACATCATGGGAACCTCCACCACATTTTGCATCCAGGGTGGCTCTACCATGGACAACAGCTTTTGACGAAAACGGCCAAATGTACTATTTGAATGTCGAC
ACTATGGAGACCCAATGGACGCCTCCGTCGACTACTCGGATGGACGGTACTGATGCTCGTGATGTGTTGACAATGACGGGAGGTCGAGGAAGGAGACCGT
CAACCGCGGAGCAAATGGTTGAGCTAAATCGATTGTTGAGTGGTGATATGGGTGACTACGAGGATCCCTCAGAAACTGAGGGTGATGGTTCTAGCCAGGT
TGAAGCGAGGCTAGATAGGGTGTCCGGCGGAGGTAGCGTCGGCGactcatcttcatcattaTCGCAGGCAACAGCCTCCCAAATCCTGGGGAAGACCTCA
ACAGGTGATCCATGTCCGTGGACGATGTTTGTCAACGCAGCAGACAGTCTTCCCTATTACTACAATAATGCCACTGGTGAGTGTTTGTGGGACCCGCCGG
AAGAGTTCCTGCGCTCAaatcagcaacaacagggACAGCAAGAAAGTGACGGGACAACAGTAGAATTGAGAGAAAGTGCAAAGACTTCTTTAGCAATGGC
CATTGAAGGGTCTAATACTCAAGACCCCACCATCCCCACCATCGAGATCTCAAAGCCAAACAGTGCGCGTCCGAAATGTGATTCAACGCAAGCCGTGGCC
ATGGCTGAGTTTGAAGAAAAGATGAATCGTGCTATCACTGCTGTCTTGAACAACTCTGTGGGTTCTAGTAACGTTAGTGTAGTTCCTGTTCACACACCTA
GCGAGCAGCTGGTCGCACCGCAGTCAGTGCTGTCTGCAGATAGTGAAGTGTCAGCAAGAACGAGTGAAGGATCTCCGCGTGCGTTTGGTGGACACTCTCG
TCCATCATCGAGCGGAGCAGTCAACCGACCTCGCACACCTTCGGTAGGTGCTGTATTGTCGAGGCATCTTGATGATATTCTCCCAGCCCAAGCAGAAAAC
GTTATGAATAAGGAATTGTGTGAAGACAAAACGGAAGAGAAAAAATGCGGCGTTCATGATGACCAAACGCCTCGATCTGGATCGAAACAAACCGAGATTG
GTGTCATAATTGCTCCTGTTACACATCCCGACGACAAAGTGCAGCCACCTGCAGATAATGTTAAAGATGAAAGTACGGGTAGCGCGCGTGGAGTTTTTGA
AGAGACATGTGTCGTTACGAACCACAATGATGAACTAGAGTTAGCTACGCTTCCGGTTGAAGAGGGAAGCGTATCTAGCGCGGATGTCATTGCTGAAGGG
ATAGTTCCAATCCAACATGAAACTACAGGTCAGAACGTGAAAGAAGCCACTGACAAGGCTAAACCAATAACGTCAACCGATGATCGAATTGAGGAAATCC
CTACCAAAGTCCCTGTTGAAAACAAAGCTGTTGCAGTAGATGCGCCCGAAAGTGCAGCGCGACCTGACGACGCACAGTTAGTTGGCGACTCTGAATTACT
AAACGAACACACTGGTGTCGACGTTCCTCTTGATGTGCTTCCAAGTATAGAGCTAGAAGAGGAAACATTGGAGCATGAAGATTCATGCACCTCC