Description :
From Genome Similarity Track
Location :
Scaffold_10:409009- 410718
Transcript NameFunction/comments
Physo_249197Hypothetical protein

Sequence
1709 bases(100 bases per row)
TGGGACGCTCGTCCGCGCAAGTACAAGAGCATTCTATTCCAGGTCTGCATCTTCATCCTCATGATGGAGCTGGCCGAGCGTCTCAGCTACTTCGGCATCA
ACCAAGGCCTCAAGAACTTCATGCAGAAAATTGGCTGGAGCTTGGTCTCCGCCAGTGCATTGAAGAGCACCTGGACGTCGATCTGTTACTTGACCCCGCT
GTTCGGCGCTTACCTGGCTGATGAGCGATGGGGCCGCTTCCGCACGATTTTGACGTTTGGTATCTGGTACTGCGTCGGTGACTTCCTCGTCGCTATCGCT
GCATACCCGACGATCATGGCCAACTCGGCCGTCGTGAACCCGATCTTCATCATCGGATTGTTTGCCGGCATTGGAATTGGTACGGGCTGTATCAAGTCGA
GCGTGATCACACTTGGTGCCGACCAGTTCAACCCTCATGATCCGAGCGAGGTCCACCAGAAGGAGACGTACTTCTCGTACTTCTACTTCTGCATCAACGT
TGGCTCAGGTGTCTCCTATGGTTATCTGTCGATCCTGTGTGTGGACGGCTCGGCCCAGATCCCTGCGGAGTACGGTTACTTCGCCACGTACATGATCTGC
GCCGTGGTGATGGCGTTCGCTGTCGTCATGCTGTGCGTCGGCTACCCTCGCTACGTGTTCCAGCCGCCGAACGACCGCTCCATCTCGATGCTGTGCAGAC
TCGTGTGGTCCAACGCCCACGAAACGCACAAGGGGTTCGTCCTTCTCCTCAGCATGTGCAGCTTCTTGGGAGCGCTGGTCGTCAACCTTCTCCGCTTCGC
ACGGAAACATCGGCAACATTCTGTCGTATATTGCTGCGGTGCTGGTGCTGGCTGGTGTGGTCTGCTGGGTGTACATCGGACAGAACCAGTCGTTCCTTGA
TTCCTCCAAGGTCAGCCAGGGCGGGGCTTTCGATGACGAGCGCGTTGAAGGATACAAGAAACTCGTGGGCGTGTTGCCGTATTCGGCCTTCACAATCATT
TGGAACTGCGCCTACGACCAGACCGACGCCAACTTCCAGTCCATTACCCAGCAGTGCGACCTTCGCCTCGACACGAGTGACCCGAAGAGCTCACAGATCC
CTGGTGCCATGTTGGGAGTCTTCGACCCGATCGTGATCGTCATCTGCATCCCCATTTTGGACTCGATCGTCTACCCGGCGTACACCAAGTGGGCCGGCAA
GTCCCCCAGTCAGTTCGGCAAGGCTGCAACTGGCCTCGCCATTGCCATCGTCGGCATCTTCTGGGCCGGCATCTTCGAGGTCATCCGTCGCAACGCTGGC
GCTCTGCAGGATGAGAACGGGGACCCCATTTTGGATGGTGGTAGTTCTCAACCTATGAACGACATCTCGTGGGGTGCTGCGGTGCCTAACTACGTCTTCA
TTGGCTTGGCTGAGTGTCTGATCAACGTCACGTCCTACGACCTCGTGTACTCTTCGGTGCCGATGTCGCTCAAGTCCATGGCCCAGGCCGTGATCCTGTT
CATGAGCTCCATGGGCAGCATCCTCACCTCGGTCTTCACCATCATGTTCTCCAAGTCGCTTCCGTCCGACAACCTGAACGAGGACCACCTCGAGAACATG
TTCTTCACCATGGGAGCAGTTAGCGCCATCAACTTCGTGTGCTTCGTGGTCGTCATGAGGAGGATGAACATGGGCATGTCCTCTTCGCCGGTGCTGGACA
CCATGGGCA