Description :
From Genome Similarity Track
Location :
Scaffold_1116:409- 2882
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_1116-abinit-gene-0.7Conserved gene of unknown function

Sequence
2473 bases(100 bases per row)
ATTAGATCGTCGGTCGTGCGAATGACTGGGAACTTTACTTGCATCTTTGCGATGACAGTCGATTGTCACCTTGGCGACGACGGCAGCCTCAAGAATCGTC
TTCTTCTGCTTCTTCACGTCGCGGTAAGCTGCATACACGCCCTCCGCTAGTTGTTCCAAATCCATGATCAAACATGCCAGTTCCATGTCGAAGTCGTGTG
CAAaTGCCTCATCAAATGGTTGAGCccGACTgCTAGcACCcGACGACACTGCTGGAGTCTGAGGTTCAATCTCAGTCATCGGATAGAAGTCGTCCGTCAA
ACTCAGCACGTCGTAGTAGTTGCTGAAGTCCAGCGTCTCAGCGACTTTGGCTTCCACGACTGGTACTATCTCCAGCTGCTGTAGCGTTTCGAGCCACTGA
CGGAGTTGACTGAGGAaGTGTTGATGTGAGTCCTCCGCCGGCgCCGGGGGgAAgTaCATGGCGGCGCGCTCACGCAGGgTGATGGCgAACTGGCACGCcG
CCcGGgCACGAGGCCAGCGCTGTATGAGTGCGGgAGGCAGCGCCGATGGATCATTGGCGATGGCCGTTACCACGTACTGGTAGACGTTGAGCTTGACGGG
CTTGGTGGCACCTTTTCCCTTCTTCTTGCCCTTGGCGTGACTCGTGGGACCTGCACCGAAGCCATAGTCGCATGCCTGTAGTAGCCAGCGCAGGAAGTGC
TCTGTGGCTcGCTTGTACTGCCCATAGATGCCGCTTGGGAACTCAGTCGTTGGCGAGCTCAGGGCGTCGCTTCGAATGAGGGAGCAAAACGGCCAGTGAG
GTTGTGTTGCATAAATCGATCAATACAATATTATTGTtGCATCATCTGCTGCCTGTGAGTCCTCTTGTCTTTGAGATCGCCTCCTCCAGTAGCGCCTGCT
CCTTCGCCACTTCCTGCATTAAGATCCGTCGGAACATCATGGCGTTCGCATGGgCTCCATGCTCCGACGATTCCTGATATCGGACGAGGAGCTCTCGTTG
AGGATTGCTATGGAATCGGTAATAGCGAGTATCGAGAAAGCGGCAGAtGGCGCGCTCTACACCGTCATCACACgTCTCTCGTCGAATCATGCATCTGTGA
TCATATCATATTAGTGAGTATGGCTGGAGTCATTTGAGTTGTGACGATGAGGTTCACGTACGCCCCGACAGGCTCGCGCATGACGTCAGTTGTCTCCATC
GTCGGGTTCAGCTCGTCATCGTCCACGAAGTCCCACAGCATCATCACTTCATTTCGCGTTTGCTggcACATGGTTACGATACGAGTCTCAACTGAGACCA
CGTCGGTGTTATGCCAACTCTTCTGCTCGATCCCCATCACGTTGTACAGGATGCTCGGCATAGCAGTGCGTTGATGCGTTCCGGATACGTTCGGGTCTTC
AATCTGTGTTCGCTTAACCTCGATGCATCTGTACTCCGGGCCGTCAAGAATGATATCTCGCACAGCAACACACGCGGCTCGcAGCGCTGTGGCCAAGTCA
GTCGTGTCTACGGCATAGACACTCGTGGTGGTCACGCCAAAGCCGTGGGTATCACGCACAATCTCTGTGTTGATGTGTGGAGCATgcACAGAAGGcAGAA
GCATTTCAGTtCcAGTCGATGCTGCAATCTCTTGGgTTTCTCGCCACAGCATGTCCATTGCCACTCGCATGCGAGTTTCTtGTGCGAGGGCGGCGTACTG
ATGCAGTCGAGCGGAGCGATCGCGGGGCAAGCGCGTGTAGTTGTGTAGATATCGACACAAGTTGAGGTCCTGaTaaGCCGTATCGTCAGTCACATATGCC
ATCTCACTGCACGCTTGTGTCTTACCACTGTAAGAGGACTGAATCCGCTGAACATCGTGCGTAGACCGCGAAGGAATCGCGTCTGGGAATACACTGCAGC
GCGTAACTGCTGACATTCGAGCTCCGCTCGGCGCcGCCTGTGGCGCTCCGTCAGCGCCTGGTCGCGTATGTCTCCTGAACCGGCCCCGACTTCGATGCGT
AGGCGCTCGAGCTCCGTAGTCAGCTGCTGCGCTTCCACCCGCAGCTGCTCCAACTCACGCTGCCCTCCATATCGCCACTtGTGAgCGCCCACTTCCAGCG
TCTCCGCCTCATGACGACGCTACCTTGTCGCGGGACTTTCGCGCAGGCTTCCTCGCCACAGGCACAGCCTCTGGTGCGTCCACAAACGCCAGCAGATCGT
CGAGAAAGGCTTCATCAATGGTGTCgTCCACCCACGTGTCTGTCATCTTCATGCGTTCGTCGACTGAACACGGAcaactCAAtgAtgaCTAGACTCAGAC
TCAGTATTTTTAGcaTGTTTTTtACCAATAgAAAaCGGACATGCACAAGTAACCCTAGTTCTGACTCAGTTATTCtAATACTGAGTCACCCATTGACGTC
GACGCACAAGTCCCCagTGCCTCGTCCTTCTCCCGACTGAGAACCCTCTGAAGCTCCACGCGTACTCCCACCC