Description :
From Genome Similarity Track
Location :
Scaffold_2380:409- 2789
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2380-snap-gene-0.2Sodium/hydrogen exchanger
Pytar_ATCC12531maker-par_contig_2380-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2380 bases(100 bases per row)
CAATGGAGGACGCCGTGCTGCTGCTGCTCATGCTCTTTGTGCTGGTCATGGCCTCGTTCATGCTGGACAAGTACTCGTGCATGCTCGTCTCGCAGAGCGG
CTTTGCGCTCGTGTTCGGCCTGCTCGTTGGGCTCTTGGTGGTGGCGAGCGGCCGCAAGGAGTCGCTCAATCGCCACCTGAACCTCAGCAACAACCTCTTC
TTCGATATTCTGCTGCCACCGATCATCTACGAAGGCGGCTTCTCGATCAAGCGCCAGGCCTTCTTCCGCAACTTCCCCGCCATCATGAGCACGGCAGTCT
TTGGCACGGTCATCGCGACGTGTGTCACGGGTGGTGCGCTGTACCTGGGTGGAATGTACAAGATCGTGACACCGCTTTCGTGGGTCGAAGCGTTTCTCTT
CGGCTCGCTCATTAGCGCCGTGGATCCCGTCGCAACACTTGCCTGCTTCAACAAACTCAACGCGCCACCTCTGCTATTCAATCTCGTGTTCGGCGAGAGC
GTGATGAACGACGCCGTTGCCATCGCGCTGTATCAGACGCTTGCCAAGTGGGAGCCGGATATCGACCTTAGCGCGAAGGAGCTGCTGCTCGTCGCCGCGA
ACACCGGCGGGATGTTTGTGTGCTCGCTGCTCGTCAGCATGGCCATCACGCTGCTCGGCGCGTACCTGCTCAAGCGCAAAATGTTTGCGACTCTGCGGCA
CTATCCGGCCTATGAGATCTCGTTGTGTCTCATTTTCAGTCTGCTCACGTACTTCATTGCCGACAGCTTGCACCTCAGCGGCATCGTTGCACTCTTCTTC
TCTGGTACCATGACGGCGCACTACCACTTCCACACGATTTCCAAGTCGGCTCAGCACTCGTTCACACACTTGCTCCACACGCTGTCCTTCATCTCGGAGA
ACTTTGTGTACCTCTTCATGGGCACTTCGGTCGTCATGCTCTTCGCGGGCCACGTCGAAAAGAGCGCTGGTGCTGCGCTCCGCGTAGATGACATTGACTG
GGCCTTCATCGGGCTCACTTTGCTCGCGTGTTTGGCTGCTCGCTTCCTCAACATTTTCCCGCTGCTGGGCCTCTCGAACTGCACGCGACCACCGGCCGAC
AGGATCCCCGTCAAGTACATGTCGGTCATTTGGTTCGCGGGGCTGCGCGGCTCGATTGCCTTTGCGTTGGCCAAGAGCTGGCAGTACAAGGGTCTCGACA
ATCATTCCCACAAGAAGCTCATCGAGTCAACGACGCTCATGATCGTCATCTTCACCACGCTCGTCATTGGTGGCTTGACGGGGCCGCTGCTCATGTGCCT
GAATCTCGCAGACTCGTCAAAGCGTACTGAGCTATCGACGGACACGGAATCCAGTGCGAACGAGAGCCCCGATGTGACGCGCCCGCCCTCGCGCTCCGGC
TCGAACACGCCCGCTCGGCGCAAGCAGCGCGGCTCGGTCCACTACATTATGTCTCGCGGAAGTATCCACCACCCGAGTGACACGCCATCAGATGCCGCCT
CTGAGATCGCGGACGACCTCGACCCCGAGACGGAGCTCACACCACGGCCGCAGTTCCAGGACAACTCGGACGAAGACGAAGACGAATGGAATTCGGCGCT
GCATCCACGCCCACCGACGATCCACCGCCAGTCGTCGCTTGGCCGACGCGAATCTTACACCGGTGCGTTCTTCCGCACGTGGAACTTTTTCGATGCCTCG
TACTTGCAGCCGATCTTCGGCGGGGAGCTCGCTCAGGCCGATGCCGCGGCGCGTCGACCAAGTTCTGCGGTCATCCACGAAGCCGTGGAGAAGTACACAA
AAGAGAACGCTGTGTGAAGCTGATCCGACTTCAATGTTGATCCAATGCAATTTATTCTACCGATCACAATTTATTGCCAAGTTCGCTCTTGCTCTGACTA
TATTTTCGGGCATGGCAATATTCAGTATTACTTGCTGCAACTTGTTGCAGTTCAGGCAATTTATTGTCCTGCTTTCTCACAAAGTTCGTTCTTCCCTCTC
TAAATCGATGGGTTCCCAATAATTCCGTGGTCATTTTTGACTGTGGAACAAACGCCAATCCACATCATTTGACGGCAACCGCGTACGCGCAATCAAACCT
CCGCGCGTCGCCACGCAGCCGGCGCGCCCGAATGACGCCGCCAACGAATCAGCACGAACACCTAGACCCTCCGGAAGCGCTGCACGACGATGGGGCGCTC
GCGAATGGCGTGGAGAACGACGACAACAACAGTGGCAGCGAGGACACCGCAGCCCTCCCGTCGGTCGAGGCCATGGAGGATCTCATCCTCGAGGCGTACA
ATAACATGCAGAGCGATGGCGAGCACATCTTTTTACCCTCGGATGTGTCCTCAAAGCTGCAACACATCGCCGAGTTGATG