Description :
From Genome Similarity Track
Location :
Scaffold_1882:409- 1630
Sequence
1221 bases(100 bases per row)
GCGCGTGAGGAAATATTGCGGCAAACACTGGACTCGTTTCAAGACGAAACAACATCGTTCGAAGATGGATGGAAGCCTGTGGGTGACAGCTACAACCTTT
TGAGACAGTTTTGTGGAGACCTTGCATCCACATTTCCGAATACTGCGACAGTGGAAAGCGATTTCTCTGTTCTAGGCTGGGAGAAGGACGCTTATCGCAA
ACGTATAACAGACTTCTCTCTAGAGGAGTTATGCACGCAAAGCAATTTCAATCACTGCAAGAGCTTGTCGAGAAGTTGAAAGTTTAGGTATACCAATACA
TTTGCATGATGAATCCCATATTCCCATATCTGAATTCTATAGCTGGCCATGTAAGGCTTCAATATGTGCAAGGTGGTCTGACCCATATTTGTGAAGGCCT
GAGCGGAGGGCACTCAAAAGACAATATTCTTCTAATTTTGGATAAGTATGAGTTACTCAAAGTGACAATATTGTTATCGTTGCTGACCCTACAAATGAAT
ATCAACTGGACGGCTCCCAGCGTCCGCCCATTTCTCCAATCTCCAAAAGAAGTTTGGGCGGGAAAatgcgggggggggggttatCGAGTTTAAAAACGCA
TGGGCAATACTCCGCAAGGAAGGATGGACTACGAAACCCCCTCCGAGCCGAAGTCTAGATCATCGCTATCGCTACATCACACCAGGCGGCAATCCTACAG
GTACCGAAGGCAACGACTTTTTTCGTGGTGAAGACGCGGTTGTCCAGTATGTTCATCAATCTCGAACACGCCGTCCAGGTTGGCGAGGGCGGCGTGGCTG
CCAGACAGCCGATTGCTTCAAGTGAGCATGGCGTTCGTGTGCGAGGTAGACATCCCGGAAGATCTGATGCTAACACATGTGTGGTCGTGTACGTGCAGAT
GCAGGTGCTGCGAGTCCTGGGTGCGTCGTGAGCACGGGCGTTgctgttggtggtgctgttcgAGGCCATGGCTATGGAAATCGTGGAAGTGGTGTGGGTC
GTGGAAGGCAGGCTACTGCTCGCAGACTGGAGGATTGGCCTGAGCAAACGACGGCAACTTGTGAATTTGAGTTTGTTGAAACTGAAGCAGTACCAACTGG
AAGCCCCACTATTATTGTAGAAGCTCGGTCTAATCATGAAGACTCGACAACTCATGTGGATATGACTCCAACACGAACGCCGCCGGTGTTACTTCAAGAT
GTGTATTTCGATCAACTGGTG